• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Euthamia Graminifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTACATCAACCATGCCAGGATGGGTCGGGCGCTCGTTCATCTGATCCTACTGGCATACCGTTGAAGTGCGGCCTAGAAGGCCCTTTATGGTCTTCGTGGTCGTTCCTTTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAATTCAAATTGAAGAATTGCCCGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGGGCGTGGCTTCTTTGTAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO9061
Plant Latin Name: Euthamia Graminifolia
Taxonomy Genus: Euthamia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 72935
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91556

Ingredient ID: NPC74764

Ingredient ID: NPC51700

Ingredient ID: NPC49124

Ingredient ID: NPC41121

Ingredient ID: NPC302634

Ingredient ID: NPC298851

Ingredient ID: NPC281131

Ingredient ID: NPC247553

Ingredient ID: NPC243728

Ingredient ID: NPC242631

Ingredient ID: NPC22563

Ingredient ID: NPC219863

Ingredient ID: NPC210867

Ingredient ID: NPC208699

Ingredient ID: NPC181138

Ingredient ID: NPC176740

Ingredient ID: NPC170707

Ingredient ID: NPC14185

Ingredient ID: NPC127546

Ingredient ID: NPC120781

Ingredient ID: NPC102949