• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anacardium Occidentale


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTGCCCGCCAGGACGACCCGCGAACATGTGCCCTCACGTCGGGGAGCCGCGGGCCTAGCGCCCGCGTGCCCCCCACCGCGCGGCGGCTGGCGGCTCTCCGCCCGCCGCGGCGCGTCAACGAACCCCGGCGCGAGTCGCGCCAAGGAATCTTACTTGAGAGGGCTCGCTCCCGTCGCCCCGTGCTCGGTGCGCGTGCGGGAAGCGTTGCCTCCTTTCATTGTCAGTGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGCCCTCCCCGGATCCTCCGGTTCCGCGGCGCTGGGCGGAAGGTGGCCTCCCGTGCGCCCGCCCGTGCGGTTGGCCCAAACGCGAGTCCTCGGCGGCGCTTCCCGCGACGGTCGGTGGCGTTCGGAACGAACCCGATGATCCCGTCGCGCGGACGCGCTCTCTCTGTGCCGCGGGCTCCTTGACCCTCGATGGCGGGCCTATGCCCGCCCGCATCGCGTCGCGACCCCAGGTCAGGCGGGATTACC

Click for details-----ITS1

TCGAAATCGATCGGAAGAACGACCCGCGAATCGTAATTGCTTACCGGAGAGTCCCCGTGAGCCCCCGAGGCCCACGGGGCTCGCGTCGGCGCGGGCCGACGAGGCCCGCGTACCGCCGACGAACGAACAAAACGTCAGCACGGATCGTGCCAAGGATCTTCGTGGAGGGAATCGTCGTCCCGCGCCCCGATCGGCCTCGATTCGGGACGGGGGCACGCGCGAGGTCTCTTACCGAGTCTAAA

Click for details-----ITS2

ATCGTCGCCCTCCCCGGATCCTCCGGTTCCGCGGCGCTGGGCGGAAGGTGGCCTCCCGTGCGCCCGCCCGTGCGGTTGGCCCAAACGCGAGTCCTCGGCGGCGCTTCCCGCGACGGTCGGTGGCGTTCGGAACGAACCCGATGATCCCGTCGCGCGGACGCGCTCTCTCTGTGCCGCGGGCTCCTTGACCCTCGATGGCGGGCCTATGCCCGCCCGCATCGCGTCGCGACCCCAGGTCAGGCGGGATTACC
Taxonomic Information

Plant ID: NPO8896
Plant Latin Name: Anacardium Occidentale
Taxonomy Genus: Anacardium
Taxonomy Family: Anacardiaceae

Plant External Links:

NCBI TaxonomyDB: 171929
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Ghana; Madagascar; Angola; South Africa; Guinea; Tanzania; Indonesia; India; Malaysia; Senegal; Zimbabwe; China; Swaziland; Sri Lanka; Thailand; Nigeria; Bolivia; Philippines

Traditional Medicine System:
Indian Folk; TCM; Homeopathy; Ayurveda; Siddha

Geographical Distribution

Brazil; Ghana; Madagascar; Angola; South Africa; Guinea; Philippines; Indonesia; India; Malaysia; Senegal; Zimbabwe; China; Swaziland; Sri Lanka; Thailand; Nigeria; Bolivia; Tanzania

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

132 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


104 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

80 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC94351

Ingredient ID: NPC94167

Ingredient ID: NPC94139

Ingredient ID: NPC93888

Ingredient ID: NPC89798

Ingredient ID: NPC85813

Ingredient ID: NPC83028

Ingredient ID: NPC79943

Ingredient ID: NPC79913

Ingredient ID: NPC71853

Ingredient ID: NPC71327

Ingredient ID: NPC65517

Ingredient ID: NPC62045

Ingredient ID: NPC61779

Ingredient ID: NPC60151

Ingredient ID: NPC57879

Ingredient ID: NPC51114

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC47844

Ingredient ID: NPC4718

Ingredient ID: NPC44489

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC38779

Ingredient ID: NPC38209

Ingredient ID: NPC3358

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC315

Ingredient ID: NPC313955

Ingredient ID: NPC31279

Ingredient ID: NPC311485

Ingredient ID: NPC306988

Ingredient ID: NPC306647

Ingredient ID: NPC305205

Ingredient ID: NPC303740

Ingredient ID: NPC303621

Ingredient ID: NPC302219

Ingredient ID: NPC301696

Ingredient ID: NPC300017

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC289475

Ingredient ID: NPC281686

Ingredient ID: NPC281387

Ingredient ID: NPC279026

Ingredient ID: NPC276222

Ingredient ID: NPC272614

Ingredient ID: NPC271527

Ingredient ID: NPC270094

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC268862

Ingredient ID: NPC264288

Ingredient ID: NPC263222

Ingredient ID: NPC261831

Ingredient ID: NPC258171

Ingredient ID: NPC257451

Ingredient ID: NPC257190

Ingredient ID: NPC251306

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC237316

Ingredient ID: NPC232881

Ingredient ID: NPC232523

Ingredient ID: NPC232375

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC209705

Ingredient ID: NPC208793

Ingredient ID: NPC204901

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC193812

Ingredient ID: NPC192

Ingredient ID: NPC189436

Ingredient ID: NPC188501

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184579

Ingredient ID: NPC179092

Ingredient ID: NPC17810

Ingredient ID: NPC176326

Ingredient ID: NPC174246

Ingredient ID: NPC168303

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC16737

Ingredient ID: NPC16525

Ingredient ID: NPC164958

Ingredient ID: NPC160512

Ingredient ID: NPC159760

Ingredient ID: NPC159312

Ingredient ID: NPC158253

Ingredient ID: NPC156654

Ingredient ID: NPC155263

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC147310

Ingredient ID: NPC142319

Ingredient ID: NPC139576

Ingredient ID: NPC137958

Ingredient ID: NPC13755

Ingredient ID: NPC130849

Ingredient ID: NPC130683

Ingredient ID: NPC126825

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC125793

Ingredient ID: NPC125564

Ingredient ID: NPC120649

Ingredient ID: NPC119039

Ingredient ID: NPC118636

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC109875

Ingredient ID: NPC108441

Ingredient ID: NPC10588

Ingredient ID: NPC10568

Ingredient ID: NPC103209

Ingredient ID: NPC100551