• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Glehnia Littoralis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTAGGGCGAGCATCGGGGGACCTTGGTCTCCTGTTTGCGAATCCCTGGTAGGTGGCCACTCCCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGATCTTAAAACTGAATTGTACGTCCGTATCCCGTTAACGGGCTCCGGCGTCTTTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCTTGCCCACAAACCACTCACACCTGAGAAGTTGTGCCGGTTTGGGGCGGAAACTGGCCTCCCGTACCTTGTCTTGCGGTTGGCGGAAAAACGAGTCTCCGGCGACGGATGTCGCGGCATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGCGAATCCTCGTCATCCTAGCGAGCTCCAGGACCCTTAGGCAGCACACACTCTGTGCGCTTCGA

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACAATTAGGGCGAGCATCGGGGGACCTTGGTCTCCTGTTTGCGAATCCCTGGTAGGTGGCCACTCCCGGGTGGCCACTGGCCTGCAAAATCATTCGGGCGCGGAATGCGCCAAGGATCTTAAAACTGAATTGTACGTCCGTATCCCGTTAACGGGCTCCGGCGTCTTTCCAAAACACAA

Click for details-----ITS2

ATCGTCTTGCCCACAAACCACTCACACCTGAGAAGTTGTGCCGGTTTGGGGCGGAAACTGGCCTCCCGTTCCTTGTCGTGCGGTTGGCGGAAAAATGAGTCTCCGGCGACGGATGTCGCGGCATCGGTGGTTGTTAAAGACCCTCTTGTCTTGTCGTGCGAATCCTCGTCATCCTAGCGAGCTCCAGGATCCTTAGGCAGCACACACTCTGTGCGCTTCGA
Taxonomic Information

Plant ID: NPO8874
Plant Latin Name: Glehnia Littoralis
Taxonomy Genus: Glehnia
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48119
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Analgesic; Antibacterial; Antipyretic; Diaphoretic; Expectorant

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

282 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


214 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

141 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC99419

Ingredient ID: NPC9880

Ingredient ID: NPC98179

Ingredient ID: NPC97790

Ingredient ID: NPC93201

Ingredient ID: NPC91574

Ingredient ID: NPC91226

Ingredient ID: NPC88789

Ingredient ID: NPC88566

Ingredient ID: NPC88461

Ingredient ID: NPC88445

Ingredient ID: NPC88118

Ingredient ID: NPC87828

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC81775

Ingredient ID: NPC81483

Ingredient ID: NPC79273

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC75816

Ingredient ID: NPC7551

Ingredient ID: NPC7491

Ingredient ID: NPC74539

Ingredient ID: NPC73311

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC70741

Ingredient ID: NPC7057

Ingredient ID: NPC68889

Ingredient ID: NPC68873

Ingredient ID: NPC67986

Ingredient ID: NPC67450

Ingredient ID: NPC6697

Ingredient ID: NPC66835

Ingredient ID: NPC63355

Ingredient ID: NPC62767

Ingredient ID: NPC61844

Ingredient ID: NPC61828

Ingredient ID: NPC60175

Ingredient ID: NPC59581

Ingredient ID: NPC57863

Ingredient ID: NPC57466

Ingredient ID: NPC56112

Ingredient ID: NPC55615

Ingredient ID: NPC55063

Ingredient ID: NPC53720

Ingredient ID: NPC52955

Ingredient ID: NPC5275

Ingredient ID: NPC52700

Ingredient ID: NPC52309

Ingredient ID: NPC52230

Ingredient ID: NPC51189

Ingredient ID: NPC51146

Ingredient ID: NPC49151

Ingredient ID: NPC49074

Ingredient ID: NPC471910

Ingredient ID: NPC471909

Ingredient ID: NPC45727

Ingredient ID: NPC43114

Ingredient ID: NPC424

Ingredient ID: NPC38751

Ingredient ID: NPC3857

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC33415

Ingredient ID: NPC33320

Ingredient ID: NPC329438

Ingredient ID: NPC327569

Ingredient ID: NPC325196

Ingredient ID: NPC324175

Ingredient ID: NPC323463

Ingredient ID: NPC32279

Ingredient ID: NPC321534

Ingredient ID: NPC321312

Ingredient ID: NPC320477

Ingredient ID: NPC320455

Ingredient ID: NPC319599

Ingredient ID: NPC317144

Ingredient ID: NPC3155

Ingredient ID: NPC31496

Ingredient ID: NPC314267

Ingredient ID: NPC31194

Ingredient ID: NPC311177

Ingredient ID: NPC310478

Ingredient ID: NPC306990

Ingredient ID: NPC303210

Ingredient ID: NPC302857

Ingredient ID: NPC301891

Ingredient ID: NPC301696

Ingredient ID: NPC301586

Ingredient ID: NPC301585

Ingredient ID: NPC300649

Ingredient ID: NPC300250

Ingredient ID: NPC296624

Ingredient ID: NPC296377

Ingredient ID: NPC296337

Ingredient ID: NPC295608

Ingredient ID: NPC294902

Ingredient ID: NPC294703

Ingredient ID: NPC294548

Ingredient ID: NPC292792

Ingredient ID: NPC292559

Ingredient ID: NPC290613

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC29

Ingredient ID: NPC289785

Ingredient ID: NPC28913

Ingredient ID: NPC288932

Ingredient ID: NPC28779

Ingredient ID: NPC287660

Ingredient ID: NPC287231

Ingredient ID: NPC286178

Ingredient ID: NPC284039

Ingredient ID: NPC283376

Ingredient ID: NPC283019

Ingredient ID: NPC281131

Ingredient ID: NPC279026

Ingredient ID: NPC278010

Ingredient ID: NPC276761

Ingredient ID: NPC276637

Ingredient ID: NPC274584

Ingredient ID: NPC273730

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC265213

Ingredient ID: NPC264784

Ingredient ID: NPC264779

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC260512

Ingredient ID: NPC255550

Ingredient ID: NPC255042

Ingredient ID: NPC253574

Ingredient ID: NPC252660

Ingredient ID: NPC251058

Ingredient ID: NPC250769

Ingredient ID: NPC2499

Ingredient ID: NPC248884

Ingredient ID: NPC248726

Ingredient ID: NPC247553

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC244315

Ingredient ID: NPC243546

Ingredient ID: NPC243509

Ingredient ID: NPC242117

Ingredient ID: NPC241847

Ingredient ID: NPC240817

Ingredient ID: NPC239270

Ingredient ID: NPC236201

Ingredient ID: NPC234536

Ingredient ID: NPC232926

Ingredient ID: NPC232375

Ingredient ID: NPC23134

Ingredient ID: NPC230301

Ingredient ID: NPC229347

Ingredient ID: NPC228806

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC226137

Ingredient ID: NPC224165

Ingredient ID: NPC222997

Ingredient ID: NPC222843

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC219564

Ingredient ID: NPC219104

Ingredient ID: NPC218918

Ingredient ID: NPC218109

Ingredient ID: NPC216723

Ingredient ID: NPC216630

Ingredient ID: NPC216092

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC211253

Ingredient ID: NPC210460

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC206132

Ingredient ID: NPC205865

Ingredient ID: NPC20363

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201109

Ingredient ID: NPC20068

Ingredient ID: NPC20045

Ingredient ID: NPC198816

Ingredient ID: NPC19834

Ingredient ID: NPC197396

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC196449

Ingredient ID: NPC196279

Ingredient ID: NPC195140

Ingredient ID: NPC194691

Ingredient ID: NPC194688

Ingredient ID: NPC193180

Ingredient ID: NPC191104

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC188238

Ingredient ID: NPC185905

Ingredient ID: NPC184049

Ingredient ID: NPC182840

Ingredient ID: NPC182102

Ingredient ID: NPC181588

Ingredient ID: NPC180871

Ingredient ID: NPC180028

Ingredient ID: NPC179950

Ingredient ID: NPC179831

Ingredient ID: NPC179037

Ingredient ID: NPC179015

Ingredient ID: NPC1788

Ingredient ID: NPC17757

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC175342

Ingredient ID: NPC173949

Ingredient ID: NPC173149

Ingredient ID: NPC172883

Ingredient ID: NPC170526

Ingredient ID: NPC168855

Ingredient ID: NPC167976

Ingredient ID: NPC166942

Ingredient ID: NPC166362

Ingredient ID: NPC163556

Ingredient ID: NPC163533

Ingredient ID: NPC16157

Ingredient ID: NPC15819

Ingredient ID: NPC156461

Ingredient ID: NPC155263

Ingredient ID: NPC155182

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC153602

Ingredient ID: NPC149320

Ingredient ID: NPC148394

Ingredient ID: NPC146197

Ingredient ID: NPC144288

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC142703

Ingredient ID: NPC141777

Ingredient ID: NPC141080

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC137115

Ingredient ID: NPC136349

Ingredient ID: NPC135088

Ingredient ID: NPC131725

Ingredient ID: NPC131431

Ingredient ID: NPC130658

Ingredient ID: NPC126240

Ingredient ID: NPC124323

Ingredient ID: NPC120926

Ingredient ID: NPC117493

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC113776

Ingredient ID: NPC111888

Ingredient ID: NPC110500

Ingredient ID: NPC109813

Ingredient ID: NPC1075

Ingredient ID: NPC107325

Ingredient ID: NPC106250

Ingredient ID: NPC103409

Ingredient ID: NPC101285

Ingredient ID: NPC100879