• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Oryza Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACACACGATCTCGGAAAAACTCTGCGAATTCTCTTTTGTACCCGGAGGGATCGTGCCCGGAGGCACGATTGTCGGTTCCAAGGTCAGAGTTCATGTGCATTTGCCGTGTACGTCCCGTTGTCGTGCGTGGCGGGATTGAGACTTTGGTTATCGTCGGAACGCCCCTGAAAACGCATGGCTTTGAGCTCGGCTCCGAGCTTGAAGTTGGGAGTCGATCCCCTCCTCCGGGAGGGAGAGCCTCTGGTGAATCTGCTGCTCCTGCCTTTTTTCAAGGCAGGAGGAGTCCGAGCCGGAGCGTTCTTCCTCCCGGGGCCCTTTTTTTCTTCTCTCCGACAAGGAACCTGGTGAAACCTAGCGTTGATGGACTGAAAGGAGGACCTTGGGCCTTTGCCAAGGCGGGAGGCTCCCTCTTGGGAGTTTCTCGCCTTGCAAACATCGAGGGAAATCCTGGAAAGTGAATTCACAAATGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCTCGTCTGAGGGCATGCCTGCCTGAGCGTCCACTCTGACCCACCCACAAACCTTTTGACTCCTCTTTCGAGAGGAGGAAAAGATGAGTGCGAGTGGAATTGGTCGTCCGGAGCCGAGTCTGTCCCCCTTGGGGGACCGTGGAAAGAGTTCCGGTTGGCTGAAAACACAGGGGCCCATTCGGTCTAGCGCGCGCTGGGAGCAATGGTGCGTCGCGAGAAGGTGCCGTCCTCGTCTGCCATCTCCTCGGAGATGGCAGAGGGGGACGTTGGTAACAAAGCGACGCGCCTCCCTGGTGGAGTCGGGATTTTGA

Click for details-----ITS1

AACACACGATCTCGGAAAAACTCTGCGAATTCTCTTTTGTACCCGGAGGGATCGTGCCCGGAGGCACGATTGTCGGTTCCAAGGTCAGAGTTCATGTGCATTTGCCGTGTACGTCCCGTTGTCGTGCGTGGCGGGATTGAGACTTTGGTTATCGTCGGAACGCCCCTGAAAACGCATGGCTTTGAGCTCGGCTCCGAGCTTGAAGTTGGGAGTCGATCCCCTCCTCCGGGAGGGAGAGCCTCTGGTGAATCTGCTGCTCCTGCCTTTTTTCAAGGCAGGAGGAGTCCGAGCCGGAGCGTTCTTCCTCCCGGGGCCCTTTTTTTCTTCTCTCCGACAAGGAACCTGGTGAAACCTAGCGTTGATGGACTGAAAGGAGGACCTTGGGCCTTTGCCAAGGCGGGAGGCTCCCTCTTGGGAGTTTCTCGCCTTGCAAACATCGAGGGAAATCCTGGAAAGTGAATTCACAAA

Click for details-----ITS2

CGCCCCCCCACCGCCTCCCACCCGCCCTCGCTCCCCTCCCGGGGCGAGTCGCGCGGTGTCGGGTCGAGTGAAAGTGGCCGTCCCAGTCGGAGCGCGCGCCGTCGCGTCCCGTGGCTGGGTCGGCTGAAATGGAGGGAACTTCGGCCGCCGTGGTGAACGCAGTCCGCGATCGGGTGAGAGATCCGGGAGTTTTGCCCGGGACTCGTAACTGTGCGTGTCTGCGTCCCCCAGTTGACCGCGTCCCCCGTGCAGGTCCCCGCGCCCCTCCCCCCTCGTCGCTCCTCCGTGAGCGCGCGCGGGGTCGAGGTGTCGCGAGCGTCACGC
Taxonomic Information

Plant ID: NPO8541
Plant Latin Name: Oryza Sativa
Taxonomy Genus: Oryza
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4530
Plant-of-the-World-Online: 316812-2

Used in Medicines

Country/Region:
Madagascar; Italy; Mexico; Philippines; Indonesia; India; South Africa; Malaysia; Zimbabwe; China; Angola; Swaziland; Thailand; South Korea; Burkina Faso; Spain

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM

Geographical Distribution

Turkmenistan; Cambodia; Swaziland; Bolivia; Cameroon; Burkina Faso; Saudi Arabia; Guatemala; Spain; Jamaica; Yemen; Pakistan; Albania; India; South Korea; Tajikistan; Turkey; Afghanistan; Bangladesh; France; Rwanda; Peru; Laos; Cote d'Ivoire; Benin; Cuba; Togo; China; Dominican Republic; Ukraine; Indonesia; Mauritius; Vietnam; Mali; Russia; Bulgaria; United States; Romania; Angola; Portugal; South Africa; Cyprus; Malaysia; Senegal; Mozambique; Japan; Niger; Brazil; Guinea; Costa Rica; Ecuador; Australia; Iran; Algeria; El Salvador; Chile; Thailand; Haiti; Belize; Georgia; Gambia; Philippines; Morocco; Guinea-Bissau; Seychelles; Chad; Mexico; Uzbekistan; Colombia; Burundi; Taiwan; Nicaragua; Madagascar; Italy; Nepal; Venezuela; Zimbabwe; Kazakhstan; Mauritania; Iraq; Trinidad and Tobago; Hungary; Honduras; Myanmar; Equatorial Guinea; Egypt; Greece; Sri Lanka; Comoros

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

265 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


119 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

108 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9848

Ingredient ID: NPC98136

Ingredient ID: NPC98086

Ingredient ID: NPC9634

Ingredient ID: NPC94989

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90769

Ingredient ID: NPC88740

Ingredient ID: NPC87366

Ingredient ID: NPC85813

Ingredient ID: NPC85468

Ingredient ID: NPC85376

Ingredient ID: NPC83111

Ingredient ID: NPC82847

Ingredient ID: NPC81775

Ingredient ID: NPC81698

Ingredient ID: NPC81010

Ingredient ID: NPC77719

Ingredient ID: NPC72003

Ingredient ID: NPC7095

Ingredient ID: NPC70744

Ingredient ID: NPC69445

Ingredient ID: NPC69394

Ingredient ID: NPC67063

Ingredient ID: NPC66352

Ingredient ID: NPC66184

Ingredient ID: NPC65089

Ingredient ID: NPC64833

Ingredient ID: NPC6332

Ingredient ID: NPC62339

Ingredient ID: NPC62045

Ingredient ID: NPC60509

Ingredient ID: NPC60151

Ingredient ID: NPC57030

Ingredient ID: NPC55286

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490340

Ingredient ID: NPC490203

Ingredient ID: NPC490197

Ingredient ID: NPC490111

Ingredient ID: NPC490031

Ingredient ID: NPC489928

Ingredient ID: NPC489907

Ingredient ID: NPC489877

Ingredient ID: NPC48623

Ingredient ID: NPC47268

Ingredient ID: NPC43094

Ingredient ID: NPC424

Ingredient ID: NPC39429

Ingredient ID: NPC39426

Ingredient ID: NPC3780

Ingredient ID: NPC36744

Ingredient ID: NPC35659

Ingredient ID: NPC33666

Ingredient ID: NPC32977

Ingredient ID: NPC329703

Ingredient ID: NPC328844

Ingredient ID: NPC328788

Ingredient ID: NPC328447

Ingredient ID: NPC326776

Ingredient ID: NPC326592

Ingredient ID: NPC326427

Ingredient ID: NPC326037

Ingredient ID: NPC323769

Ingredient ID: NPC323644

Ingredient ID: NPC323579

Ingredient ID: NPC323349

Ingredient ID: NPC322434

Ingredient ID: NPC322244

Ingredient ID: NPC321606

Ingredient ID: NPC321475

Ingredient ID: NPC321251

Ingredient ID: NPC321167

Ingredient ID: NPC319984

Ingredient ID: NPC319257

Ingredient ID: NPC319172

Ingredient ID: NPC318701

Ingredient ID: NPC318587

Ingredient ID: NPC318407

Ingredient ID: NPC318328

Ingredient ID: NPC317120

Ingredient ID: NPC316926

Ingredient ID: NPC316773

Ingredient ID: NPC316582

Ingredient ID: NPC313955

Ingredient ID: NPC311722

Ingredient ID: NPC309318

Ingredient ID: NPC308809

Ingredient ID: NPC307755

Ingredient ID: NPC306799

Ingredient ID: NPC306478

Ingredient ID: NPC304876

Ingredient ID: NPC302857

Ingredient ID: NPC302812

Ingredient ID: NPC300745

Ingredient ID: NPC300414

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC295835

Ingredient ID: NPC295644

Ingredient ID: NPC295154

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC2907

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC290003

Ingredient ID: NPC288230

Ingredient ID: NPC288056

Ingredient ID: NPC286146

Ingredient ID: NPC285322

Ingredient ID: NPC285081

Ingredient ID: NPC282731

Ingredient ID: NPC281686

Ingredient ID: NPC281457

Ingredient ID: NPC280717

Ingredient ID: NPC280714

Ingredient ID: NPC279658

Ingredient ID: NPC279370

Ingredient ID: NPC278010

Ingredient ID: NPC277367

Ingredient ID: NPC276659

Ingredient ID: NPC275861

Ingredient ID: NPC272614

Ingredient ID: NPC271607

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265701

Ingredient ID: NPC265395

Ingredient ID: NPC265305

Ingredient ID: NPC263503

Ingredient ID: NPC261831

Ingredient ID: NPC26033

Ingredient ID: NPC257213

Ingredient ID: NPC256142

Ingredient ID: NPC253786

Ingredient ID: NPC251407

Ingredient ID: NPC250696

Ingredient ID: NPC250046

Ingredient ID: NPC249983

Ingredient ID: NPC249471

Ingredient ID: NPC249375

Ingredient ID: NPC24656

Ingredient ID: NPC242580

Ingredient ID: NPC242262

Ingredient ID: NPC241278

Ingredient ID: NPC24101

Ingredient ID: NPC237812

Ingredient ID: NPC237549

Ingredient ID: NPC235195

Ingredient ID: NPC233806

Ingredient ID: NPC233570

Ingredient ID: NPC233443

Ingredient ID: NPC233196

Ingredient ID: NPC230542

Ingredient ID: NPC228204

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC223737

Ingredient ID: NPC22303

Ingredient ID: NPC222936

Ingredient ID: NPC221504

Ingredient ID: NPC221482

Ingredient ID: NPC220568

Ingredient ID: NPC219918

Ingredient ID: NPC219143

Ingredient ID: NPC216630

Ingredient ID: NPC215754

Ingredient ID: NPC214502

Ingredient ID: NPC213876

Ingredient ID: NPC213552

Ingredient ID: NPC213285

Ingredient ID: NPC208793

Ingredient ID: NPC208380

Ingredient ID: NPC205844

Ingredient ID: NPC205713

Ingredient ID: NPC205522

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201773

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC199067

Ingredient ID: NPC198539

Ingredient ID: NPC198455

Ingredient ID: NPC19697

Ingredient ID: NPC196776

Ingredient ID: NPC195727

Ingredient ID: NPC190742

Ingredient ID: NPC19074

Ingredient ID: NPC189436

Ingredient ID: NPC187861

Ingredient ID: NPC186708

Ingredient ID: NPC185755

Ingredient ID: NPC183815

Ingredient ID: NPC183542

Ingredient ID: NPC181211

Ingredient ID: NPC181133

Ingredient ID: NPC18074

Ingredient ID: NPC180664

Ingredient ID: NPC178177

Ingredient ID: NPC17810

Ingredient ID: NPC175580

Ingredient ID: NPC17450

Ingredient ID: NPC174246

Ingredient ID: NPC173813

Ingredient ID: NPC170526

Ingredient ID: NPC168220

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC167072

Ingredient ID: NPC165473

Ingredient ID: NPC165260

Ingredient ID: NPC163699

Ingredient ID: NPC161881

Ingredient ID: NPC160951

Ingredient ID: NPC15917

Ingredient ID: NPC158333

Ingredient ID: NPC156913

Ingredient ID: NPC156654

Ingredient ID: NPC154819

Ingredient ID: NPC152451

Ingredient ID: NPC151422

Ingredient ID: NPC150950

Ingredient ID: NPC14958

Ingredient ID: NPC147983

Ingredient ID: NPC142703

Ingredient ID: NPC139354

Ingredient ID: NPC139037

Ingredient ID: NPC138335

Ingredient ID: NPC137958

Ingredient ID: NPC137167

Ingredient ID: NPC136473

Ingredient ID: NPC136014

Ingredient ID: NPC135226

Ingredient ID: NPC133856

Ingredient ID: NPC131698

Ingredient ID: NPC130683

Ingredient ID: NPC128093

Ingredient ID: NPC127857

Ingredient ID: NPC126681

Ingredient ID: NPC124578

Ingredient ID: NPC123965

Ingredient ID: NPC121712

Ingredient ID: NPC120464

Ingredient ID: NPC1173

Ingredient ID: NPC114410

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112523

Ingredient ID: NPC112216

Ingredient ID: NPC111888

Ingredient ID: NPC111446

Ingredient ID: NPC110899

Ingredient ID: NPC110297

Ingredient ID: NPC110126

Ingredient ID: NPC109816

Ingredient ID: NPC10776

Ingredient ID: NPC104863

Ingredient ID: NPC10282

Ingredient ID: NPC101043