• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pithecellobium Clypearia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGGTGCCACACCAAAAGAGCGACCCGCGAACCGGTTGGAATGAACTCTAGCGGGGGAGGGCGACGGCGCGCCCGAGGCCTCTCCCGGCAACCAAACCCCGGCGCCTCAGGCGCCAAGGAACCGAAACAGAGCGAGGCGCTCGCTGGCGGCCCGGGAACGGCGCCGAACACCCAGCGTCGCGTCTCATGCCACTGGCATCCGAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCTTCGTGTCGCCCCATTCTATCTCAACTTTCTTTTAAAGAGAGATGCGTGTTTGGGACGGATAATGGTCTCCTGTTCGTACTTTATGAGCAGTTGGCCGAAATACAAGTCCATACGAAAGGACAACACGGTTAGTGGTGGTTGAGAAACTGTTGCGCACCCGTGTAACTTCTTTTGGATTTATTGACCCTTGGTGCCTTACGGTGCATCGACTGC

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGGTGCCACACCAAAAGAGCGACCCGCGAACCGGTTGGAATGAACTCTAGCGGGGGAGGGCGACGGCGCGCCCGAGGCCTCTCCCGGCAACCAAACCCCGGCGCCTCAGGCGCCAAGGAACCGAAACAGAGCGAGGCGCTCGCTGGCGGCCCGGGAACGGCGCCGAACACCCAGCGTCGCGTCTCATGCCACTGGCATCCGAAA

Click for details-----ITS2

AACGTCGCCAAAGCCCTTATGCTCTGGGCYTGGCGGATGATGGCCTCCCGGGAGCCTCGCCTCCCGGATGGCCGAAAGAGGGGCCCGACGTGACGACTGCCACGATCCACGGTGGTTGAGCGAACACTCGCTCGAGGCCAAGACGTGCGCGTGTCGTCCCACGGCAAGGGCCCGTCGGGTGGGCATGCGACGGCAGAGCCCTCCGCCAGTACGCACGCGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO8524
Plant Latin Name: Pithecellobium Clypearia
Taxonomy Genus: Pithecellobium
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 714486
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; India

Traditional Medicine System:
Indian Folk

Geographical Distribution

Thailand; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

68 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


52 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9609

Ingredient ID: NPC95460

Ingredient ID: NPC89944

Ingredient ID: NPC8463

Ingredient ID: NPC66868

Ingredient ID: NPC59650

Ingredient ID: NPC58716

Ingredient ID: NPC54172

Ingredient ID: NPC52005

Ingredient ID: NPC473818

Ingredient ID: NPC45367

Ingredient ID: NPC44931

Ingredient ID: NPC42149

Ingredient ID: NPC41979

Ingredient ID: NPC38884

Ingredient ID: NPC327767

Ingredient ID: NPC318432

Ingredient ID: NPC308289

Ingredient ID: NPC302426

Ingredient ID: NPC299089

Ingredient ID: NPC293588

Ingredient ID: NPC287387

Ingredient ID: NPC282116

Ingredient ID: NPC279525

Ingredient ID: NPC274499

Ingredient ID: NPC26937

Ingredient ID: NPC263251

Ingredient ID: NPC261947

Ingredient ID: NPC258104

Ingredient ID: NPC255580

Ingredient ID: NPC255497

Ingredient ID: NPC249616

Ingredient ID: NPC241579

Ingredient ID: NPC220518

Ingredient ID: NPC21534

Ingredient ID: NPC215317

Ingredient ID: NPC212591

Ingredient ID: NPC210003

Ingredient ID: NPC20836

Ingredient ID: NPC20505

Ingredient ID: NPC204443

Ingredient ID: NPC204204

Ingredient ID: NPC203891

Ingredient ID: NPC196209

Ingredient ID: NPC192978

Ingredient ID: NPC189142

Ingredient ID: NPC187206

Ingredient ID: NPC183401

Ingredient ID: NPC182277

Ingredient ID: NPC181465

Ingredient ID: NPC176740

Ingredient ID: NPC176728

Ingredient ID: NPC176300

Ingredient ID: NPC169232

Ingredient ID: NPC165287

Ingredient ID: NPC16209

Ingredient ID: NPC160951

Ingredient ID: NPC156222

Ingredient ID: NPC153701

Ingredient ID: NPC136014

Ingredient ID: NPC12529

Ingredient ID: NPC123928

Ingredient ID: NPC115275

Ingredient ID: NPC11433

Ingredient ID: NPC110070

Ingredient ID: NPC109594

Ingredient ID: NPC109024

Ingredient ID: NPC101692