• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Picrasma Quassioides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCCCTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCAGCAGAACGACCCGCGAACCAGTGATGCATGCCGGTGGGGGAGAGGCGCCGGGCGCGCGAGCGTCGGGCGTCTCGCCCTCCCCTCGTCGCGGGATGGGGTCCCGTCCGCGAGTCCCGTTCCCGCGACGTAACAACGAACCCGGGCGCGGACTGCGCCAAGGAAATACAACGAGAGAGCGTTCTCCCGCCGCCCCGTACACGGTGCGCGCGCGGGAGGGCCGCCTTCTTTCACTTAATCCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCCTCGCGCCCGCCTCCCTGAGGCGGAGCGGTCGGGGCGGAAAATGGCCTCCCGTGTGCTCCCCGCAAGCGGTTGGCCGAAATTCGAGTCCTCGGCGACAGTTGCCGCGACGATCGGTGGTGAAACCAAAGCCTCGAGTTACCGTCGCGCGCCGCTGTCCCCGGGCAAAGGGCTCCTGGACCCTGATGCGCCGAACGAACGGCGCTCGCT

Click for details-----ITS1

TCCCTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCAGCAGAACGACCCGCGAACCAGTGATGCATGCCGGTGGGGGAGAGGCGCCGGGCGCGCGAGCGTCGGGCGTCTCGCCCTCCCCTCGTCGCGGGATGGGGTCCCGTCCGCGAGTCCCGTTCCCGCGACGTAACAACGAACCCGGGCGCGGACTGCGCCAAGGAAATACAACGAGAGAGCGTTCTCCCGCCGCCCCGTACACGGTGCGCGCGCGGGAGGGCCGCCTTCTTTCACTTAATCCACAA

Click for details-----ITS2

ATCGTCGCCCCCCTCGCGCCCGCCTCCCTGAGGCGGAGCGGTCGGGGCGGAAAATGGCCTCCCGTGTGCTCCCCGCAAGCGGTTGGCCGAAATTCGAGTCCTCGGCGACAGTTGCCGCGACGATCGGTGGTGAAACCAAAGCCTCGAGTTACCGTCGCGCGCCGCTGTCCCCGGGCAAAGGGCTCCTGGACCCTGATGCGCCGAACGAACGGCGCTCGCT
Taxonomic Information

Plant ID: NPO8372
Plant Latin Name: Picrasma Quassioides
Taxonomy Genus: Picrasma
Taxonomy Family: Simaroubaceae

Plant External Links:

NCBI TaxonomyDB: 210334
Plant-of-the-World-Online: 813963-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM; Unani; Ayurveda


Medicinal Functions:

Anthelmintic; Antiviral; Bitter; Febrifuge; Hypotensive; Parasiticide; Stomachic; Tonic

Geographical Distribution

South Africa; Nepal; India; China; Japan; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

174 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


124 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

87 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96312

Ingredient ID: NPC91882

Ingredient ID: NPC90426

Ingredient ID: NPC85599

Ingredient ID: NPC81751

Ingredient ID: NPC81044

Ingredient ID: NPC8022

Ingredient ID: NPC75844

Ingredient ID: NPC7510

Ingredient ID: NPC73969

Ingredient ID: NPC72157

Ingredient ID: NPC71174

Ingredient ID: NPC69202

Ingredient ID: NPC65080

Ingredient ID: NPC64274

Ingredient ID: NPC63545

Ingredient ID: NPC634

Ingredient ID: NPC60206

Ingredient ID: NPC56870

Ingredient ID: NPC53534

Ingredient ID: NPC52501

Ingredient ID: NPC52411

Ingredient ID: NPC51063

Ingredient ID: NPC50628

Ingredient ID: NPC48938

Ingredient ID: NPC484812

Ingredient ID: NPC484811

Ingredient ID: NPC484810

Ingredient ID: NPC484809

Ingredient ID: NPC484808

Ingredient ID: NPC484807

Ingredient ID: NPC484806

Ingredient ID: NPC484805

Ingredient ID: NPC484804

Ingredient ID: NPC484803

Ingredient ID: NPC484802

Ingredient ID: NPC484801

Ingredient ID: NPC484800

Ingredient ID: NPC484799

Ingredient ID: NPC484798

Ingredient ID: NPC484797

Ingredient ID: NPC484796

Ingredient ID: NPC484795

Ingredient ID: NPC484794

Ingredient ID: NPC484793

Ingredient ID: NPC484792

Ingredient ID: NPC484791

Ingredient ID: NPC484790

Ingredient ID: NPC484789

Ingredient ID: NPC484788

Ingredient ID: NPC484787

Ingredient ID: NPC484786

Ingredient ID: NPC484785

Ingredient ID: NPC484784

Ingredient ID: NPC484783

Ingredient ID: NPC484782

Ingredient ID: NPC484781

Ingredient ID: NPC484780

Ingredient ID: NPC484779

Ingredient ID: NPC484778

Ingredient ID: NPC484777

Ingredient ID: NPC475921

Ingredient ID: NPC470799

Ingredient ID: NPC469554

Ingredient ID: NPC469553

Ingredient ID: NPC469552

Ingredient ID: NPC43993

Ingredient ID: NPC43301

Ingredient ID: NPC42716

Ingredient ID: NPC41060

Ingredient ID: NPC329291

Ingredient ID: NPC32737

Ingredient ID: NPC327350

Ingredient ID: NPC32595

Ingredient ID: NPC325682

Ingredient ID: NPC325035

Ingredient ID: NPC321714

Ingredient ID: NPC319392

Ingredient ID: NPC318848

Ingredient ID: NPC318752

Ingredient ID: NPC315239

Ingredient ID: NPC314954

Ingredient ID: NPC313827

Ingredient ID: NPC313680

Ingredient ID: NPC310758

Ingredient ID: NPC308227

Ingredient ID: NPC301191

Ingredient ID: NPC298713

Ingredient ID: NPC295697

Ingredient ID: NPC294285

Ingredient ID: NPC293899

Ingredient ID: NPC29373

Ingredient ID: NPC293487

Ingredient ID: NPC290428

Ingredient ID: NPC288987

Ingredient ID: NPC285332

Ingredient ID: NPC28471

Ingredient ID: NPC284509

Ingredient ID: NPC279143

Ingredient ID: NPC27814

Ingredient ID: NPC268872

Ingredient ID: NPC267928

Ingredient ID: NPC26679

Ingredient ID: NPC266249

Ingredient ID: NPC26543

Ingredient ID: NPC260992

Ingredient ID: NPC258027

Ingredient ID: NPC254847

Ingredient ID: NPC250288

Ingredient ID: NPC247553

Ingredient ID: NPC245816

Ingredient ID: NPC239954

Ingredient ID: NPC238499

Ingredient ID: NPC238140

Ingredient ID: NPC237402

Ingredient ID: NPC235807

Ingredient ID: NPC232142

Ingredient ID: NPC230542

Ingredient ID: NPC229198

Ingredient ID: NPC227119

Ingredient ID: NPC221873

Ingredient ID: NPC216809

Ingredient ID: NPC216116

Ingredient ID: NPC214720

Ingredient ID: NPC213971

Ingredient ID: NPC213858

Ingredient ID: NPC212565

Ingredient ID: NPC212213

Ingredient ID: NPC209621

Ingredient ID: NPC208636

Ingredient ID: NPC208591

Ingredient ID: NPC207749

Ingredient ID: NPC207656

Ingredient ID: NPC202781

Ingredient ID: NPC19872

Ingredient ID: NPC193631

Ingredient ID: NPC191415

Ingredient ID: NPC190604

Ingredient ID: NPC189282

Ingredient ID: NPC185782

Ingredient ID: NPC183182

Ingredient ID: NPC182222

Ingredient ID: NPC180719

Ingredient ID: NPC178227

Ingredient ID: NPC178014

Ingredient ID: NPC1775

Ingredient ID: NPC176740

Ingredient ID: NPC176005

Ingredient ID: NPC175153

Ingredient ID: NPC172710

Ingredient ID: NPC169265

Ingredient ID: NPC169123

Ingredient ID: NPC168911

Ingredient ID: NPC156222

Ingredient ID: NPC155255

Ingredient ID: NPC152620

Ingredient ID: NPC148889

Ingredient ID: NPC141053

Ingredient ID: NPC13672

Ingredient ID: NPC130385

Ingredient ID: NPC12649

Ingredient ID: NPC119449

Ingredient ID: NPC118940

Ingredient ID: NPC118647

Ingredient ID: NPC115976

Ingredient ID: NPC11422

Ingredient ID: NPC113243

Ingredient ID: NPC112885

Ingredient ID: NPC111741

Ingredient ID: NPC109110

Ingredient ID: NPC104861

Ingredient ID: NPC102755

Ingredient ID: NPC101543

Ingredient ID: NPC100564