• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vaccaria Hispanica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGCAGAACGACCCGTGAACGTGTTTACTTATAATGGCTTGCGTGCCATCGTGCCCCTTGCCTAAGCTTGGAAGCGCTCGCTTGTTGGGTGCTTCCTTGCTGCATAAACGATCCCCGGCGCTAAAAGCGTCAAGGAACATGAACTTAAAGTGAGGCACTTGTCCCTGCTTGGTTAGCCATGCGGGGCAGGTGTCGTGTCTTGACATAAAAATAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCTCCCCCACAACCCAATCAGTGGAGGGAAGGATGATGGCTTCCCGTGCCTCACCCGGTGCGGTTGGCCTAAAAATGGAGCCCGTGGTACTAAGTTCTCGCGGCGATAGGTGGTGAACAAGGCTTCGGCCGTGCTAACAACCTGCCTCGAATCTTTATGCCTTGTGCGCTCGTTGGACCCTTTGATGTTGCCTTTGGCGACCCAAACCTATGCGACCCCAGGTCAG

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAACAACCAGCGAACATGTTCACTACTCGGTCGTGGTGCGTTGCTGGGTGCCGTGTGCACTCGCTCGCCCCGCAACCGCCTAGGGCATCTCTCTCGAGAGACCACCTTGGCAAAATAACAAAAACCCGGCGCGAAAGCGTCAAGGAACATAACATTAATGTGTGCAACCTCCCGCTGCCCGGTCATCCGTGCACGGGTGTGATGCCATGTACTAACAATAAA

Click for details-----ITS2

ATTGCGTCTCCCCCACAACCCAATCAGTGGAGGGAAGGATGATGGCTTCCCGTGCCTCACCCGGTGCGGTTGGCCTAAAAATGGAGCCCGTGGTACTAAGTTCTCGCGGCGATAGGTGGTGAACAAGGCTTCGGCCGTGCTAACAACCTGCCTCGAATCTTTATGCCTTGTGCGCTCGTTGGACCCTTTGATGTTGCCTTTGGCGACCCAAACCTATGCGACCCCAGGTCAG
Taxonomic Information

Plant ID: NPO829
Plant Latin Name: Vaccaria Hispanica
Taxonomy Genus: Vaccaria
Taxonomy Family: Caryophyllaceae

Plant External Links:

NCBI TaxonomyDB: 39387
Plant-of-the-World-Online: 159710-1

Used in Medicines

Country/Region:
Turkey; India

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Anodyne; Antiphlogistic; Antipruritic; Diuretic; Emmenagogue; Febrifuge; Galactogogue; Oxytoxic; Styptic; Vulnerary

Geographical Distribution

Brazil; Turkey; Italy; Bangladesh; France; Ethiopia; Belarus; Algeria; Japan; China; Belgium; Germany; Spain; Ukraine; Eritrea; Netherlands; Libya; Poland; Mauritius; Morocco; Hungary; Switzerland; Russia; Bulgaria; United States; Romania; Albania; Portugal; South Africa; Egypt; India; Tunisia; Austria; Greece; Kenya; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

81 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


41 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

33 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98710

Ingredient ID: NPC93365

Ingredient ID: NPC88758

Ingredient ID: NPC86412

Ingredient ID: NPC84319

Ingredient ID: NPC8180

Ingredient ID: NPC80192

Ingredient ID: NPC76782

Ingredient ID: NPC75519

Ingredient ID: NPC75287

Ingredient ID: NPC71566

Ingredient ID: NPC68357

Ingredient ID: NPC66577

Ingredient ID: NPC55679

Ingredient ID: NPC55668

Ingredient ID: NPC5295

Ingredient ID: NPC51700

Ingredient ID: NPC4574

Ingredient ID: NPC43553

Ingredient ID: NPC43246

Ingredient ID: NPC42752

Ingredient ID: NPC34010

Ingredient ID: NPC312903

Ingredient ID: NPC310956

Ingredient ID: NPC309267

Ingredient ID: NPC308083

Ingredient ID: NPC304763

Ingredient ID: NPC298869

Ingredient ID: NPC298062

Ingredient ID: NPC289774

Ingredient ID: NPC288537

Ingredient ID: NPC283760

Ingredient ID: NPC283655

Ingredient ID: NPC282413

Ingredient ID: NPC28138

Ingredient ID: NPC278128

Ingredient ID: NPC277917

Ingredient ID: NPC270768

Ingredient ID: NPC268705

Ingredient ID: NPC267691

Ingredient ID: NPC267517

Ingredient ID: NPC267489

Ingredient ID: NPC264711

Ingredient ID: NPC263548

Ingredient ID: NPC260268

Ingredient ID: NPC251854

Ingredient ID: NPC248826

Ingredient ID: NPC236271

Ingredient ID: NPC231063

Ingredient ID: NPC230754

Ingredient ID: NPC220498

Ingredient ID: NPC219345

Ingredient ID: NPC217115

Ingredient ID: NPC215843

Ingredient ID: NPC214988

Ingredient ID: NPC214662

Ingredient ID: NPC214150

Ingredient ID: NPC213629

Ingredient ID: NPC192582

Ingredient ID: NPC192411

Ingredient ID: NPC189224

Ingredient ID: NPC187515

Ingredient ID: NPC185238

Ingredient ID: NPC174356

Ingredient ID: NPC170435

Ingredient ID: NPC163076

Ingredient ID: NPC160105

Ingredient ID: NPC159561

Ingredient ID: NPC157534

Ingredient ID: NPC142415

Ingredient ID: NPC138978

Ingredient ID: NPC136600

Ingredient ID: NPC120287

Ingredient ID: NPC117663

Ingredient ID: NPC114239

Ingredient ID: NPC109813

Ingredient ID: NPC107454

Ingredient ID: NPC106591

Ingredient ID: NPC105246

Ingredient ID: NPC104316

Ingredient ID: NPC101475