• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Geijera Parviflora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAGACCTCTGCCCAGCAGAACGACCCGCGAACTCGTGAAAACACCGGAGAGGGGGCGCRAGCTCCCCTCCACCCGCCCCGGGTGCGGGACCCGTCCCGTTCCCCGCGGCGGACCAACGAACCCACGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCMTGGGGCCCCAGACTCGGTGCGCCCCGGGACGCGGCGCCTTCTTTCACTTTAGTCCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO8274
Plant Latin Name: Geijera Parviflora
Taxonomy Genus: Geijera
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 1226077
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC74749

Ingredient ID: NPC482652

Ingredient ID: NPC300596

Ingredient ID: NPC298093

Ingredient ID: NPC284743

Ingredient ID: NPC273959

Ingredient ID: NPC254416

Ingredient ID: NPC231893

Ingredient ID: NPC208956

Ingredient ID: NPC180340

Ingredient ID: NPC165549

Ingredient ID: NPC110233