• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Corydalis Yanhusuo


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACCTGCCCAGCAGAACGACCCGCGAACACGTGATGCCCCCGGTTACGCCGGACGGGTGACGGCGGCGTAAAAACCCGCCCCCCCGCCCGGACAAAACGAACCCCAGGCGCGGTCCGCGCCAAGGAAAACGAACAACGGATCGGGCGCCCCGCAAGGAAGCGCCCCCCGAAATCTTAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCGAGTCGCCCCCATCCCTCTACTTACCGAGAGGGGGGGGGAGAGGATAGRGCCCCCCCGYGCCASTCCGCGCGGCCGGCCCAAACACAGGCCCCGGGAGGCCGACGTCACGATCCGTGGTGGTTGTAAAAGACACGCCCTCGAAACCGGATCCCGTGCACGCCGCGCCGCGACCCGGAGGGCCACAGCGACCCCCCAGGGCTGTCCTTGGACGGCGCCCACTCTG

Click for details-----ITS1

AACCTGCCCAGCAGAACGACCCGCGAACACGTGATGCCCCCGGTTACGCCGGACGGGTGACGGCGGCGTAAAAACCCGCCCCCCCGCCCGGACAAAACGAACCCCAGGCGCGGTCCGCGCCAAGGAAAACGAACAACGGATCGGGCGCCCCGCAAGGAAGCGCCCCCCGAAATCTTAA

Click for details-----ITS2

ACCGAGTCGCCCCCATCCCTCTACTTACCGAGAGGGGGGGGGAGAGGATAGRGCCCCCCCGYGCCASTCCGCGCGGCCGGCCCAAACACAGGCCCCGGGAGGCCGACGTCACGATCCGTGGTGGTTGTAAAAGACACGCCCTCGAAACCGGATCCCGTGCACGCCGCGCCGCGACCCGGAGGGCCACAGCGACCCCCCAGGGCTGTCCTTGGACGGCGCCCACTCTG
Taxonomic Information

Plant ID: NPO827
Plant Latin Name: Corydalis Yanhusuo
Taxonomy Genus: Corydalis
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 458692
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antiseptic; Antispasmodic; Antitussive; Cancer; Cardiotonic; Hypotensive; Sedative

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

122 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


114 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

68 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99659

Ingredient ID: NPC98535

Ingredient ID: NPC92650

Ingredient ID: NPC92213

Ingredient ID: NPC91382

Ingredient ID: NPC88429

Ingredient ID: NPC86469

Ingredient ID: NPC83511

Ingredient ID: NPC78990

Ingredient ID: NPC78222

Ingredient ID: NPC77572

Ingredient ID: NPC7467

Ingredient ID: NPC74344

Ingredient ID: NPC73222

Ingredient ID: NPC69999

Ingredient ID: NPC67978

Ingredient ID: NPC66396

Ingredient ID: NPC56198

Ingredient ID: NPC55348

Ingredient ID: NPC54379

Ingredient ID: NPC53069

Ingredient ID: NPC5238

Ingredient ID: NPC51957

Ingredient ID: NPC50864

Ingredient ID: NPC481466

Ingredient ID: NPC481465

Ingredient ID: NPC481464

Ingredient ID: NPC481463

Ingredient ID: NPC481462

Ingredient ID: NPC481461

Ingredient ID: NPC481460

Ingredient ID: NPC481459

Ingredient ID: NPC481458

Ingredient ID: NPC481457

Ingredient ID: NPC481456

Ingredient ID: NPC481455

Ingredient ID: NPC45960

Ingredient ID: NPC428

Ingredient ID: NPC41178

Ingredient ID: NPC4071

Ingredient ID: NPC4040

Ingredient ID: NPC39701

Ingredient ID: NPC38407

Ingredient ID: NPC325962

Ingredient ID: NPC325871

Ingredient ID: NPC323841

Ingredient ID: NPC31930

Ingredient ID: NPC317840

Ingredient ID: NPC316906

Ingredient ID: NPC313189

Ingredient ID: NPC31311

Ingredient ID: NPC308267

Ingredient ID: NPC302527

Ingredient ID: NPC297670

Ingredient ID: NPC295691

Ingredient ID: NPC285117

Ingredient ID: NPC281059

Ingredient ID: NPC279011

Ingredient ID: NPC277178

Ingredient ID: NPC270275

Ingredient ID: NPC268214

Ingredient ID: NPC2663

Ingredient ID: NPC264642

Ingredient ID: NPC26267

Ingredient ID: NPC249797

Ingredient ID: NPC247389

Ingredient ID: NPC245942

Ingredient ID: NPC244968

Ingredient ID: NPC24019

Ingredient ID: NPC237663

Ingredient ID: NPC234392

Ingredient ID: NPC234228

Ingredient ID: NPC230991

Ingredient ID: NPC226652

Ingredient ID: NPC224651

Ingredient ID: NPC216459

Ingredient ID: NPC211608

Ingredient ID: NPC210437

Ingredient ID: NPC209195

Ingredient ID: NPC207757

Ingredient ID: NPC206897

Ingredient ID: NPC204828

Ingredient ID: NPC202768

Ingredient ID: NPC202605

Ingredient ID: NPC198462

Ingredient ID: NPC195291

Ingredient ID: NPC193949

Ingredient ID: NPC188813

Ingredient ID: NPC184724

Ingredient ID: NPC184026

Ingredient ID: NPC183485

Ingredient ID: NPC171409

Ingredient ID: NPC166543

Ingredient ID: NPC164892

Ingredient ID: NPC16452

Ingredient ID: NPC164203

Ingredient ID: NPC163436

Ingredient ID: NPC16107

Ingredient ID: NPC156461

Ingredient ID: NPC150540

Ingredient ID: NPC146512

Ingredient ID: NPC145832

Ingredient ID: NPC139389

Ingredient ID: NPC138488

Ingredient ID: NPC138487

Ingredient ID: NPC13826

Ingredient ID: NPC137918

Ingredient ID: NPC136860

Ingredient ID: NPC136508

Ingredient ID: NPC135549

Ingredient ID: NPC135322

Ingredient ID: NPC134386

Ingredient ID: NPC128019

Ingredient ID: NPC12053

Ingredient ID: NPC120445

Ingredient ID: NPC116392

Ingredient ID: NPC115096

Ingredient ID: NPC112206

Ingredient ID: NPC112172

Ingredient ID: NPC106295

Ingredient ID: NPC101715

Ingredient ID: NPC101638