• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pedicularis Muscicola


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TGTCGAATCCTGCAAAAGCAGACCGCGAACACGTTAAACCGCATTGGGACCGCGGGTCTTGGGGAGACTCTTTGCCCGCGCCCAAATCTCGCACTGTGCGCGCCTCGGCGTGCATTGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACTTATAGAAGCGTCATCCTCTCATCGCCCCGTACGCGGTGTGCGCTGGGGGGAACTGACGTCTCTCCAATGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO8242
Plant Latin Name: Pedicularis Muscicola
Taxonomy Genus: Pedicularis
Taxonomy Family: Orobanchaceae

Plant External Links:

NCBI TaxonomyDB: 1348741
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

1 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93930

Ingredient ID: NPC62677

Ingredient ID: NPC50461

Ingredient ID: NPC310948

Ingredient ID: NPC303619

Ingredient ID: NPC253258

Ingredient ID: NPC148893

Ingredient ID: NPC143386

Ingredient ID: NPC135022

Ingredient ID: NPC116816

Ingredient ID: NPC103587