• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Stylotrichium Rotundifolium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

AGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAGGCAAAACAACCCGTGAACGTGTATAATAAGATGGCCTGACGGGTATTGATTCTTTTTGTTTCAAACCCCTTGAGGCCTGTCGACGTGTGTCCGTGGTGTCTCTTTTGGCACCCTCGGTATCACGTTGACGCAACAACAACCCCCGGCACAACAAGTGCCAAGGAAAACAAAACTTAAGAGTGCCCGTGCAATGATTCCCCGTACTAGGTGTGTTCATTGTGTGTGGCTTCTTTGTAATCTTGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO8214
Plant Latin Name: Stylotrichium Rotundifolium
Taxonomy Genus: Stylotrichium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1745160
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC83089

Ingredient ID: NPC8220

Ingredient ID: NPC51700

Ingredient ID: NPC27765

Ingredient ID: NPC271652

Ingredient ID: NPC260323

Ingredient ID: NPC230301

Ingredient ID: NPC220930

Ingredient ID: NPC176130

Ingredient ID: NPC149203

Ingredient ID: NPC145379

Ingredient ID: NPC142415

Ingredient ID: NPC120840

Ingredient ID: NPC119190