• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trigonella Foenum-Graecum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATAGTCGATGCCTTACAAGCAGTCCAACACGTGAATCAGTTTGAACACATAGGGGTGGGTTGAGGTGTTAACCACCTCCGCCTACCTCAGGTTCAGAGGTGGACGACTCGTGCGTTCTCCTTTGTGCCAACAAAACAAACCCCGGCGCTGAATGCGTCAAGGAATTAAAATTTAGCTCTGAGCGCAACCTGCATGGCATGCATCGGAGACGGTGTTCGTGCGGGTTACGTTTTGACACATTATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTCATGCCAATTTCCTTTTTTAGTAGGTATTGTGCATGCTGGTGAATGTTGGCCTCCCGTGAGCTCTATTGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGAACCAAGATCATGTGCTTCCCTATTCAATTTGGCCTCTTTTACCCATATGCGTTTTGTGAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCT

Click for details-----ITS1

TTCTGTAGGTGAACTTGCGGAAGGATCATAGTCGATGCCTTACAAGCAGTCCAACACGTGAATCAGTTTGAACACATAGGGGTGGGTTGAGGTGTTAACCACCTCCGCCTACCTCAGGTTCAGAGGTGGACGACTCGTGCGTTCTCCTTTGTGCCAACAAAACAAACCCAGGCGCTGAATGCGTCAAGGAATTAAAATTTAGCTCTGAGCGCAACCTGCATGGCATGCATCGGAGACGGTGTTCGTGCGGGTTACGTTTTGACACATTATATAGAA

Click for details-----ITS2

ATCGAAGCCTCATGCCAATTTCCTTTTTTAGTAGGTATTGTGCATGCTGGTGAATGTTGGCCTCCCGTGAGCTCTATTGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGAACCAAGATCATGTGCTTCCCTATTCAATTTGGCCTCTTTTACCCATATGCGTTTTGTGAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCT
Taxonomic Information

Plant ID: NPO8210
Plant Latin Name: Trigonella Foenum-Graecum
Taxonomy Genus: Trigonella
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 78534
Plant-of-the-World-Online: 523957-1

Used in Medicines

Country/Region:
Canada; Israel; Turkmenistan; Algeria; India; Indonesia; Lebanon; Jordan; Chile; Argentina; Iraq; Spain

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha


Medicinal Functions:

Anticholesterolemic; Antiinflammatory; Antiphlogistic; Antitumor; Appetizer; Cardiotonic; Carminative; Demulcent; Deobstruent; Diuretic; Emollient; Expectorant; Febrifuge; Galactogogue; Hypoglycaemic; Hypotensive; Laxative; Parasiticide; Restorative

Geographical Distribution

Canada; Afghanistan; Italy; Bangladesh; Sudan; Kuwait; Mali; France; Ethiopia; Argentina; Turkmenistan; Israel; Lebanon; Iran; Algeria; Turkey; Jordan; Zimbabwe; China; Chile; Belgium; Germany; Iraq; Spain; Ukraine; Nepal; Libya; Oman; Tanzania; Indonesia; Saudi Arabia; Tajikistan; Morocco; Kenya; Switzerland; Yemen; Russia; Bulgaria; Pakistan; Romania; Albania; Portugal; Myanmar; Tunisia; Cyprus; India; Uzbekistan; Austria; Mozambique; Greece; Hungary; Fiji

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

219 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


92 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

72 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99016

Ingredient ID: NPC98696

Ingredient ID: NPC98555

Ingredient ID: NPC98257

Ingredient ID: NPC97824

Ingredient ID: NPC97700

Ingredient ID: NPC94250

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC8747

Ingredient ID: NPC86688

Ingredient ID: NPC8526

Ingredient ID: NPC84956

Ingredient ID: NPC83963

Ingredient ID: NPC82839

Ingredient ID: NPC81792

Ingredient ID: NPC81063

Ingredient ID: NPC80710

Ingredient ID: NPC80334

Ingredient ID: NPC79943

Ingredient ID: NPC77869

Ingredient ID: NPC77349

Ingredient ID: NPC76336

Ingredient ID: NPC75322

Ingredient ID: NPC7479

Ingredient ID: NPC72194

Ingredient ID: NPC72093

Ingredient ID: NPC71458

Ingredient ID: NPC70744

Ingredient ID: NPC67541

Ingredient ID: NPC63318

Ingredient ID: NPC6298

Ingredient ID: NPC62045

Ingredient ID: NPC61139

Ingredient ID: NPC60175

Ingredient ID: NPC56867

Ingredient ID: NPC55412

Ingredient ID: NPC54764

Ingredient ID: NPC54538

Ingredient ID: NPC53558

Ingredient ID: NPC53545

Ingredient ID: NPC52956

Ingredient ID: NPC490121

Ingredient ID: NPC489928

Ingredient ID: NPC489907

Ingredient ID: NPC47517

Ingredient ID: NPC47319

Ingredient ID: NPC46801

Ingredient ID: NPC46190

Ingredient ID: NPC45782

Ingredient ID: NPC45677

Ingredient ID: NPC4538

Ingredient ID: NPC44321

Ingredient ID: NPC43094

Ingredient ID: NPC4268

Ingredient ID: NPC39591

Ingredient ID: NPC39426

Ingredient ID: NPC37852

Ingredient ID: NPC37691

Ingredient ID: NPC37578

Ingredient ID: NPC35067

Ingredient ID: NPC34877

Ingredient ID: NPC33747

Ingredient ID: NPC329536

Ingredient ID: NPC328740

Ingredient ID: NPC327103

Ingredient ID: NPC326355

Ingredient ID: NPC325114

Ingredient ID: NPC32441

Ingredient ID: NPC323526

Ingredient ID: NPC322294

Ingredient ID: NPC320280

Ingredient ID: NPC317120

Ingredient ID: NPC315603

Ingredient ID: NPC313955

Ingredient ID: NPC313179

Ingredient ID: NPC312416

Ingredient ID: NPC311485

Ingredient ID: NPC311473

Ingredient ID: NPC310098

Ingredient ID: NPC309585

Ingredient ID: NPC305227

Ingredient ID: NPC304909

Ingredient ID: NPC302780

Ingredient ID: NPC294902

Ingredient ID: NPC294656

Ingredient ID: NPC294409

Ingredient ID: NPC293832

Ingredient ID: NPC292318

Ingredient ID: NPC292279

Ingredient ID: NPC288426

Ingredient ID: NPC287295

Ingredient ID: NPC285973

Ingredient ID: NPC283923

Ingredient ID: NPC283790

Ingredient ID: NPC282265

Ingredient ID: NPC281686

Ingredient ID: NPC281255

Ingredient ID: NPC280102

Ingredient ID: NPC278976

Ingredient ID: NPC277677

Ingredient ID: NPC273855

Ingredient ID: NPC272614

Ingredient ID: NPC272343

Ingredient ID: NPC270735

Ingredient ID: NPC270077

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265305

Ingredient ID: NPC263031

Ingredient ID: NPC25913

Ingredient ID: NPC257296

Ingredient ID: NPC257040

Ingredient ID: NPC256078

Ingredient ID: NPC255885

Ingredient ID: NPC255204

Ingredient ID: NPC254942

Ingredient ID: NPC254894

Ingredient ID: NPC254772

Ingredient ID: NPC252085

Ingredient ID: NPC250751

Ingredient ID: NPC24556

Ingredient ID: NPC245554

Ingredient ID: NPC243645

Ingredient ID: NPC242419

Ingredient ID: NPC240336

Ingredient ID: NPC239788

Ingredient ID: NPC239416

Ingredient ID: NPC237812

Ingredient ID: NPC237804

Ingredient ID: NPC236203

Ingredient ID: NPC235126

Ingredient ID: NPC234560

Ingredient ID: NPC234106

Ingredient ID: NPC233124

Ingredient ID: NPC230085

Ingredient ID: NPC22845

Ingredient ID: NPC227260

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC220270

Ingredient ID: NPC220125

Ingredient ID: NPC21937

Ingredient ID: NPC219143

Ingredient ID: NPC217741

Ingredient ID: NPC21547

Ingredient ID: NPC214758

Ingredient ID: NPC21461

Ingredient ID: NPC213876

Ingredient ID: NPC209846

Ingredient ID: NPC209560

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC196638

Ingredient ID: NPC19513

Ingredient ID: NPC194701

Ingredient ID: NPC194293

Ingredient ID: NPC190385

Ingredient ID: NPC187770

Ingredient ID: NPC186179

Ingredient ID: NPC185755

Ingredient ID: NPC185137

Ingredient ID: NPC184054

Ingredient ID: NPC183359

Ingredient ID: NPC18326

Ingredient ID: NPC18223

Ingredient ID: NPC180145

Ingredient ID: NPC17810

Ingredient ID: NPC1769

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC17230

Ingredient ID: NPC170052

Ingredient ID: NPC167400

Ingredient ID: NPC166225

Ingredient ID: NPC165410

Ingredient ID: NPC16366

Ingredient ID: NPC163209

Ingredient ID: NPC15825

Ingredient ID: NPC156694

Ingredient ID: NPC156654

Ingredient ID: NPC152451

Ingredient ID: NPC151808

Ingredient ID: NPC150950

Ingredient ID: NPC150324

Ingredient ID: NPC14970

Ingredient ID: NPC149649

Ingredient ID: NPC148699

Ingredient ID: NPC148235

Ingredient ID: NPC147983

Ingredient ID: NPC146025

Ingredient ID: NPC144229

Ingredient ID: NPC142108

Ingredient ID: NPC141357

Ingredient ID: NPC140310

Ingredient ID: NPC139075

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC132904

Ingredient ID: NPC130530

Ingredient ID: NPC129185

Ingredient ID: NPC126681

Ingredient ID: NPC121509

Ingredient ID: NPC120464

Ingredient ID: NPC118773

Ingredient ID: NPC117418

Ingredient ID: NPC117295

Ingredient ID: NPC116280

Ingredient ID: NPC11433

Ingredient ID: NPC114289

Ingredient ID: NPC112890

Ingredient ID: NPC112819

Ingredient ID: NPC109504

Ingredient ID: NPC103209

Ingredient ID: NPC102256

Ingredient ID: NPC101785