• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Artocarpus Altilis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGATCATTGTCGAAACCTGCCCAGCAGAAAGACCCGCGAACAGGTTACAACGTTTGGGGGGCGAGGGGTGCAACGCGCCTCGAACCCCCCCCMACCCCAAGSSSSCGTGGTTTTTCCCCGGGTCTTGGGCCCCCAACCAACCCCGGCGCGRAATGCKTCAAGGAAACATAAAGAAACGAGCTTSTGCTGCGGCCCCAGGTCTGGTGCTTGCCGCAGCAGGAGGTGTCGTGTTTCGTCTAGGTCTAAAAACGACTTTCGGCAACGGATWTTTCGGTTTTCGCATCGATAAAAAACGTAGCAAAATGCGATACTTGGGGTGTAAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCATGGGCGTCACACATCGTTGCCCCCCTAAGTCCCTTTGACACTGTCCACACGGTGCAAGGGGGACTGCGAGCGGCGGATGATGGCCTCCCGTGGGCCTCGACTCGCGGTTGGTCTAAATTTGGGTCCTCGGTCACGGCAGCCGTGGCAACAGGTGGTCGTCGATGATTCGGTGCCCTGCCACGTGCTCCGGACAAAAGCGTCGAGAGACCCCACAAACTTGACCCCGATGCACCCCACTTCGGTGCTTCCAACGCGACCCTAGGTCAGCG

Click for details-----ITS1

CTGCGGAAGATCATTGTCGAAACCTGCCCAGCAGAAAGACCCGCGAACAGGTTACAACGTTTGGGGGGCGAGGGGTGCAACGCGCCTCGAACCCCCCCCMACCCCAAGSSSSCGTGGTTTTTCCCCGGGTCTTGGGCCCCCAACCAACCCCGGCGCGRAATGCKTCAAGGAAACATAAAGAAACGAGCTTSTGCTGCGGCCCCAGGTCTGGTGCTTGCCGCAGCAGGAGGTGTCGTGTTTCGTCTAGGTCTAAAAA

Click for details-----ITS2

ATCGTTGCCCCCCTAAGTCCCTTTGACACTGTCCACACGGTGCAAGGGGGACTGCGAGCGGCGGATGATGGCCTCCCGTGGGCCTCGACTCGCGGTTGGTCTAAATTTGGGTCCTCGGTCACGGCAGCCGTGGCAACAGGTGGTCGTCGATGATTCGGTGCCCTGCCACGTGCTCCGGACAAAAGCGTCGAGAGACCCCACAAACTTGACCCCGATGCACCCCACTTCGGTGCTTCCAACGCGACCCCAGTCAGGGCG
Taxonomic Information

Plant ID: NPO8171
Plant Latin Name: Artocarpus Altilis
Taxonomy Genus: Artocarpus
Taxonomy Family: Moraceae

Plant External Links:

NCBI TaxonomyDB: 194251
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Nigeria; Indonesia; China; India

Traditional Medicine System:
TCM; Ayurveda; Siddha

Geographical Distribution

India; Nigeria; Indonesia; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

96 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


50 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

57 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC9356

Ingredient ID: NPC88023

Ingredient ID: NPC85813

Ingredient ID: NPC75584

Ingredient ID: NPC74404

Ingredient ID: NPC68517

Ingredient ID: NPC65426

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC55412

Ingredient ID: NPC489907

Ingredient ID: NPC45826

Ingredient ID: NPC39834

Ingredient ID: NPC37468

Ingredient ID: NPC35

Ingredient ID: NPC32940

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC312368

Ingredient ID: NPC302857

Ingredient ID: NPC294815

Ingredient ID: NPC294548

Ingredient ID: NPC290030

Ingredient ID: NPC287570

Ingredient ID: NPC282348

Ingredient ID: NPC281686

Ingredient ID: NPC281461

Ingredient ID: NPC277907

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC26960

Ingredient ID: NPC258442

Ingredient ID: NPC258236

Ingredient ID: NPC254696

Ingredient ID: NPC251102

Ingredient ID: NPC246683

Ingredient ID: NPC246380

Ingredient ID: NPC242580

Ingredient ID: NPC240053

Ingredient ID: NPC238943

Ingredient ID: NPC237812

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC215435

Ingredient ID: NPC214669

Ingredient ID: NPC213876

Ingredient ID: NPC213157

Ingredient ID: NPC210298

Ingredient ID: NPC209528

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC202340

Ingredient ID: NPC200819

Ingredient ID: NPC1940

Ingredient ID: NPC19174

Ingredient ID: NPC189087

Ingredient ID: NPC188646

Ingredient ID: NPC188093

Ingredient ID: NPC187770

Ingredient ID: NPC186444

Ingredient ID: NPC185755

Ingredient ID: NPC184649

Ingredient ID: NPC184248

Ingredient ID: NPC184049

Ingredient ID: NPC181465

Ingredient ID: NPC17834

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC171620

Ingredient ID: NPC1712

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC14316

Ingredient ID: NPC142319

Ingredient ID: NPC140191

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135694

Ingredient ID: NPC13486

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC12323

Ingredient ID: NPC118700

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC110249

Ingredient ID: NPC107091