• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Veronica Arvensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTGTAAAACAGACCGCGAACACGTGTTAATCAACTCGCCAGCCGGGCGCTCGCGCTCGGTCGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTCAAAGGAAGCGTCGCCCCTAGGACGCCCGTCCGCGGTGCGCCCTGGGCGCGCGACGCCCCTCGAAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCAAAATCCCCAGGGACTTGYGAGTGGGWGCGGAAAATGGTCTCCCGTGTGCCTTCGTGCGCGCGGCTGGCCTAAATGAGATCCTGCATCGACGGATGTCACGACCGTGGTGGTTGAAAACTCAATCYWGCTGTCGTGCGYGCCTCGTCGTTTGCAAGGCATCGAATCGACCCAACGGCGCGCTTCGCGTGCCTCCGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCACTCCAACGTCCCTAGGGACTTTGCGAGCGGGCGCGGAAATTGGTCTCCCGTGCGCCTCTCGGCCCGCGGCTGGCCTAAATGAGATCCTGCATCGATGGATGTCACGACCAGTGGTGGTTGATAACTCAATCGTGCTGTCGTGCGTCGACAAGTCGCTTGCTAGGCATCCTGCAAAAACAAAACGGCGCCTCGCGCGCCTACGA
Taxonomic Information

Plant ID: NPO8127
Plant Latin Name: Veronica Arvensis
Taxonomy Genus: Veronica
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 46032
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Alterative; Antiscorbutic; Diuretic

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC87317

Ingredient ID: NPC73855

Ingredient ID: NPC50898

Ingredient ID: NPC35167

Ingredient ID: NPC312450

Ingredient ID: NPC311485

Ingredient ID: NPC294852

Ingredient ID: NPC279121

Ingredient ID: NPC251296

Ingredient ID: NPC250436

Ingredient ID: NPC225710

Ingredient ID: NPC220825

Ingredient ID: NPC217387

Ingredient ID: NPC210632

Ingredient ID: NPC20791

Ingredient ID: NPC200477

Ingredient ID: NPC195749

Ingredient ID: NPC19388

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC146095

Ingredient ID: NPC140925

Ingredient ID: NPC11669

Ingredient ID: NPC113855

Ingredient ID: NPC107334