• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rehmannia Glutinosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACATGTTTAACCACATCGGGACCGTGGTGTGGGGGCAACCTCTCGCCGCGTTCCCTTCCTGCTGGCGTGCACGTGAGTGCTCGTCGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAGAAGCATCCGCCTTCCATCGCCCCGTCCGCGGTGCGCGAGGGGGGAAAGGATGTCTCTCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCCTCGTCCCTATGTGGCGATCGTTGGGTGGGGGCGGATAATGGCCTCCCGTGCGCAGTGTTGCGCGGCTGGCCCAAATGCGATCCCGCGGCGGCGCACGTCACGACCAGTGGTGGTTGAACACTCAACTCGCGTGCTGTCGTGCCGGACGACGTCGTCTTCTCGGGCATCGTCACAGACCCAATGGTGCGAGTCATTCGCGCTTACGACCGCGACCCCAGGTCAGGC

Click for details-----ITS1

GCGGAAGGATCATTGTCGAAACCTGCAAAGTAGACCGCGGACATGTTTAACCACATAGGGACCGTGGTGGGGCGGCAACCTCTCGCCGCGTTCCCTTCCTACTGGAGTGCATGTTAGTGCTCGTCGTGCGGGCTAACGAACCCCGGTGCGGCATGCGCCAAGGAAAACTCAAAGAAGCATCCGCCTTCCATCGCCCCGTCCACGGTGCGCGAGAGGGGGAAAGGATATCTCTCGAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCCCCTTCGTCCCTATGTGGCGATCGTTGGGTGGGGGCGGATAATGGCCTCCCGTGCGCAGTGTTGCGCGGCTGGCCCAAATGCGATCCCGCGGCGGCGCACGTCACGACCAGTGGTGGTTGAACACTCAACTCGCGTGCTGTCATGCCGGACGACGTCGTCTTCTCGGGCATCGTCACAGACCCAATGGTGCGAGTCATTCGCGCTTACGACCGCGACCCCAGG
Taxonomic Information

Plant ID: NPO8101
Plant Latin Name: Rehmannia Glutinosa
Taxonomy Genus: Rehmannia
Taxonomy Family: Orobanchaceae

Plant External Links:

NCBI TaxonomyDB: 99300
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Antiseptic; Cardiac; Diuretic; Febrifuge; Haemostatic; Hypoglycaemic; Skin; Tonic

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

248 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


122 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9992

Ingredient ID: NPC96218

Ingredient ID: NPC95755

Ingredient ID: NPC94644

Ingredient ID: NPC94324

Ingredient ID: NPC89297

Ingredient ID: NPC89145

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC85402

Ingredient ID: NPC84938

Ingredient ID: NPC83963

Ingredient ID: NPC82669

Ingredient ID: NPC81515

Ingredient ID: NPC80641

Ingredient ID: NPC79999

Ingredient ID: NPC79593

Ingredient ID: NPC7502

Ingredient ID: NPC73740

Ingredient ID: NPC73427

Ingredient ID: NPC72993

Ingredient ID: NPC70756

Ingredient ID: NPC70744

Ingredient ID: NPC68880

Ingredient ID: NPC64141

Ingredient ID: NPC62765

Ingredient ID: NPC6248

Ingredient ID: NPC61198

Ingredient ID: NPC56730

Ingredient ID: NPC55490

Ingredient ID: NPC53028

Ingredient ID: NPC52681

Ingredient ID: NPC50485

Ingredient ID: NPC48598

Ingredient ID: NPC47882

Ingredient ID: NPC470685

Ingredient ID: NPC470684

Ingredient ID: NPC470683

Ingredient ID: NPC44448

Ingredient ID: NPC44063

Ingredient ID: NPC43257

Ingredient ID: NPC43246

Ingredient ID: NPC424

Ingredient ID: NPC38002

Ingredient ID: NPC3780

Ingredient ID: NPC37409

Ingredient ID: NPC37132

Ingredient ID: NPC36061

Ingredient ID: NPC34927

Ingredient ID: NPC3488

Ingredient ID: NPC34877

Ingredient ID: NPC3357

Ingredient ID: NPC33174

Ingredient ID: NPC328788

Ingredient ID: NPC326944

Ingredient ID: NPC326885

Ingredient ID: NPC324750

Ingredient ID: NPC323787

Ingredient ID: NPC323434

Ingredient ID: NPC322476

Ingredient ID: NPC32222

Ingredient ID: NPC321534

Ingredient ID: NPC319451

Ingredient ID: NPC319246

Ingredient ID: NPC318748

Ingredient ID: NPC318017

Ingredient ID: NPC316926

Ingredient ID: NPC315672

Ingredient ID: NPC312927

Ingredient ID: NPC310601

Ingredient ID: NPC307876

Ingredient ID: NPC306610

Ingredient ID: NPC306344

Ingredient ID: NPC305307

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC300228

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC298257

Ingredient ID: NPC298105

Ingredient ID: NPC296651

Ingredient ID: NPC295098

Ingredient ID: NPC292918

Ingredient ID: NPC292869

Ingredient ID: NPC291650

Ingredient ID: NPC291309

Ingredient ID: NPC290469

Ingredient ID: NPC289758

Ingredient ID: NPC288532

Ingredient ID: NPC28779

Ingredient ID: NPC287335

Ingredient ID: NPC28598

Ingredient ID: NPC285773

Ingredient ID: NPC28446

Ingredient ID: NPC282895

Ingredient ID: NPC282551

Ingredient ID: NPC280717

Ingredient ID: NPC280390

Ingredient ID: NPC279026

Ingredient ID: NPC2766

Ingredient ID: NPC276298

Ingredient ID: NPC272820

Ingredient ID: NPC265803

Ingredient ID: NPC264946

Ingredient ID: NPC263385

Ingredient ID: NPC262958

Ingredient ID: NPC262718

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC259296

Ingredient ID: NPC258501

Ingredient ID: NPC258342

Ingredient ID: NPC257885

Ingredient ID: NPC254053

Ingredient ID: NPC2499

Ingredient ID: NPC249598

Ingredient ID: NPC249422

Ingredient ID: NPC249045

Ingredient ID: NPC248753

Ingredient ID: NPC248453

Ingredient ID: NPC248427

Ingredient ID: NPC244574

Ingredient ID: NPC244293

Ingredient ID: NPC238343

Ingredient ID: NPC236709

Ingredient ID: NPC235800

Ingredient ID: NPC234209

Ingredient ID: NPC234132

Ingredient ID: NPC234066

Ingredient ID: NPC233500

Ingredient ID: NPC232869

Ingredient ID: NPC23145

Ingredient ID: NPC231138

Ingredient ID: NPC229475

Ingredient ID: NPC229347

Ingredient ID: NPC228051

Ingredient ID: NPC226429

Ingredient ID: NPC225783

Ingredient ID: NPC225710

Ingredient ID: NPC223177

Ingredient ID: NPC222294

Ingredient ID: NPC222155

Ingredient ID: NPC220089

Ingredient ID: NPC219804

Ingredient ID: NPC219656

Ingredient ID: NPC217246

Ingredient ID: NPC216630

Ingredient ID: NPC215578

Ingredient ID: NPC213935

Ingredient ID: NPC212226

Ingredient ID: NPC21209

Ingredient ID: NPC209970

Ingredient ID: NPC208818

Ingredient ID: NPC208620

Ingredient ID: NPC206800

Ingredient ID: NPC203719

Ingredient ID: NPC203286

Ingredient ID: NPC201844

Ingredient ID: NPC201268

Ingredient ID: NPC200210

Ingredient ID: NPC199698

Ingredient ID: NPC199561

Ingredient ID: NPC199024

Ingredient ID: NPC197677

Ingredient ID: NPC197316

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC196130

Ingredient ID: NPC19417

Ingredient ID: NPC192248

Ingredient ID: NPC192065

Ingredient ID: NPC191046

Ingredient ID: NPC190085

Ingredient ID: NPC189855

Ingredient ID: NPC18950

Ingredient ID: NPC187521

Ingredient ID: NPC186653

Ingredient ID: NPC185255

Ingredient ID: NPC18335

Ingredient ID: NPC18188

Ingredient ID: NPC181153

Ingredient ID: NPC179704

Ingredient ID: NPC178887

Ingredient ID: NPC178500

Ingredient ID: NPC177213

Ingredient ID: NPC176523

Ingredient ID: NPC176017

Ingredient ID: NPC174368

Ingredient ID: NPC171736

Ingredient ID: NPC170597

Ingredient ID: NPC170065

Ingredient ID: NPC168267

Ingredient ID: NPC167594

Ingredient ID: NPC16728

Ingredient ID: NPC165932

Ingredient ID: NPC164700

Ingredient ID: NPC163933

Ingredient ID: NPC163783

Ingredient ID: NPC163627

Ingredient ID: NPC163004

Ingredient ID: NPC162282

Ingredient ID: NPC160359

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC156330

Ingredient ID: NPC154186

Ingredient ID: NPC150610

Ingredient ID: NPC148534

Ingredient ID: NPC146374

Ingredient ID: NPC146197

Ingredient ID: NPC145287

Ingredient ID: NPC14330

Ingredient ID: NPC142753

Ingredient ID: NPC13943

Ingredient ID: NPC139029

Ingredient ID: NPC138850

Ingredient ID: NPC137169

Ingredient ID: NPC137167

Ingredient ID: NPC136699

Ingredient ID: NPC135353

Ingredient ID: NPC132311

Ingredient ID: NPC130683

Ingredient ID: NPC130600

Ingredient ID: NPC124318

Ingredient ID: NPC123400

Ingredient ID: NPC121322

Ingredient ID: NPC120454

Ingredient ID: NPC119949

Ingredient ID: NPC11848

Ingredient ID: NPC115859

Ingredient ID: NPC114705

Ingredient ID: NPC114539

Ingredient ID: NPC113741

Ingredient ID: NPC113219

Ingredient ID: NPC112062

Ingredient ID: NPC10827

Ingredient ID: NPC10781

Ingredient ID: NPC107482

Ingredient ID: NPC107334

Ingredient ID: NPC1060

Ingredient ID: NPC105610

Ingredient ID: NPC104564

Ingredient ID: NPC103798

Ingredient ID: NPC103614

Ingredient ID: NPC100998

Ingredient ID: NPC100551