CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Phlomoides Hamosa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACTTACAAAGCAGACTGCGAACACGTTCAACACAACCCCGGGCCCGCGGGGGGCGGGCAACCTCCCGCCGCGATCCCGACCCCCGCCGGTGCGGGTGCTTGCGCCCAAGCTGTGCGGGCTAACGAACTCGGGCGCGGAATGCGCCAAGGAAAACACAATGGAGCGCCCACCTCCCCGCCGCGTCCTGTTCGCGGGGCGCTGGGGAGCAAGGGACGCCTGTAAGAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCCCNCGGGGTGGGGCGGAGATTGGCCCCCCGTGCGCAGCGATGCGCGCGGTCGGCCCAAATGCGAATCCGCCGTCGATGCTCGTCGCGACCAGTGGTGGTTGAACTATCAACTCGCGTGCTGTCGTGCTCCACGGCATCGTCGGTCCGGAGATGGCCTAGAAACCCAATGGCGCGAGCACGCATCGTGCCCACGACCGAGACCCCAG

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCCCCTCCCCCNCGGGGTGGGGCGGAGATTGGCCCCCCGTGCGCAGCGATGCGCGCGGTCGGCCCAAATGCGAATCCGCCGTCGATGCTCGTCGCGACCAGTGGTGGTTGAACTATCAACTCGCGTGCTGTCGTGCTCCACGGCATCGTCGGTCCGGAGATGGCCTAGAAACCCAATGGCGCGAGCACGCATCGTGCCCACGACCGAGACCCCAG

Taxonomic Information

Plant ID: NPO8062
Plant Latin Name: Phlomoides Hamosa
Taxonomy Genus: Phlomoides
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 694375
Plant-of-the-World-Online: 77110365-1

Used in Medicines

Unknown.

Geographical Distribution

Nepal; China; Myanmar

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC51700

Ingredient ID: NPC43312

Ingredient ID: NPC299856

Ingredient ID: NPC290495

Ingredient ID: NPC27765

Ingredient ID: NPC272068

Ingredient ID: NPC264317

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC20791

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC156654

Ingredient ID: NPC147883

Ingredient ID: NPC142754

Ingredient ID: NPC113733

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	34

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Quercetin (NPC20791)	NP level
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1,MET,ALOX5,ACHE,AURKB,XDH,F2,ALOX5,AURKB
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA,FLT3,PIM1,AURKB,TP53,SRC,KDM1A,AXL
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,CA2,MET,CA4,RORC,ACHE,NOX4,XDH
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,CA12,IGF1R,CDK1,SRC,CA4,AURKB,NOX4
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2,CDK1,ALOX15,MET,NPSR1,AURKB,NOX4,CYP19A1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,F2,CDK1,ALOX12,NPSR1,AURKB,CA7,XDH
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,F2,CDK1,ACHE,NPSR1,AURKB,CA7,XDH
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,CDK1,CA2,NPSR1,AURKB,ALOX15,XDH,CYP1A1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CDK1,MET,CA4,AURKB,NOX4,CYP19A1,CA7
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,MET,ALOX5,CYP1B1,NOX4,CA7,XDH
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,KDR,CA2,MET,CYP1B1,CYP19A1,CSNK2A3
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	TP53,SRC,FLT3,KDM1A,AURKB,CDK1
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	FLT3,MET,IGF1R,TP53,EGFR,KDR
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDK1,ALOX15,ACHE,NPSR1,AURKB,NOX4
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CA2,MET,AURKB,CYP1A2,CYP1A1
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	IGF1R,MET,CSNK2A1,EGFR,KDR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MET,SRC,TP53,EGFR,KDR
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TP53,MET,FLT3,SRC,KDR
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,AXL,IGF1R,KDR,FLT3
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,TP53,AXL,KDM1A,EGFR
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04851821,NCT04536090,NCT04622865,NCT04853199,NCT04733651
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14,F2,CA4,RORC,ABCG2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2,MET,NPSR1,NOX4,CYP1A1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA14,CA2,ACHE,ALOX15,CYP1A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FLT3,ALOX15,ACHE,CYP1B1,HSD17B10
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	EGFR,KDR,MET,TP53
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH,IGF1R NCT02552888,NCT02848131
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	SRC,F2,RORC,RELA
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	KDR,ACHE,FLT3,MET
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	IGF1R,SRC,EGFR,TP53
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA4,CA2,CA12,CA14
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,FLT3,TP53,KDR
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MET,EGFR,KDR NCT00701987
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,MET,EGFR NCT02446795
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2,SRC,KDR,MET
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	KDR,TP53,EGFR,MET
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,AXL,TP53,EGFR
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2,ALOX5,RELA,ABCG2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,ACHE,CA2,CA4
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ALOX5,RORC,FLT3,RELA
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2,NPSR1,AURKB,NOX4
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	AXL,MET,ACHE,CYP19A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CDK1,AURKB,CA12,XDH
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	SRC,ACHE,CA2,CA4
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP1A2,CA2,AURKB,CDK1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	AXL,CYP19A1,XDH,EGFR
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	EGFR,KDR,MET
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA4,CA2,CA12
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4,ALOX5,F2
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1,MET,TP53
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	IGF1R,ACHE,ALOX5
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	RELA,F2 NCT01839344
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDK1,EGFR,ALOX5
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KDM1A,SRC,FLT3
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	KDR,MET,SRC
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR,EGFR,FLT3
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2,ALOX5,KDR
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,EGFR,KDR
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB NCT01705652,NCT04403568
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15,NOX4 NCT01912820
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,NOX4,ABCG2
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	YES1,ACHE,CYP1A1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CDK1,AURKB,CA12
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FLT3,MET,AXL
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE,MET,AXL
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MET,AXL,CDK1,AURKB,POLB,CA4,KDM1A,CA12,RELA,CSNK2A1,FLT3,ALOX5,SRC,XDH,CA2,TP53,CA14,YES1,PIM1,EGFR,KDR,RORC,IGF1R
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A,EGFR
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5,RELA
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R,ALOX5
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3,CDK1
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	SRC,KDR
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH,ALOX5
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	FLT3,SRC
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4,MET
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	ALOX5,FLT3
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	SRC,IGF1R
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA,ABCG2
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,AURKB
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53,SRC
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	SRC,KDR
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA,ALOX5
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH,CA2
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC,ALOX5
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE,SRC
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53,SRC
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,MET
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2,EGFR
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53,SRC
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT04946383,NCT05422885
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04514510,NCT04474626
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT04907253,NCT03943459
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT03989271,NCT01708278
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,CDK1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE,AXL
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CDK1,CA12
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB,ABCG2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	FLT3,NOX4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1,ABCG2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,NOX4
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA14,RECQL,ABCG2,ALOX5,CYP1B1,ALOX15,CA7,F2,AXL,CA2,XDH,PIM1,POLB,MET,ACHE,NPSR1,AURKB,CES1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CDK1,RECQL,ALOX5,ALOX15,CA7,EGFR,AXL,SRC,KDR,CSNK2A2,XDH,PIM1,FLT3,MET,AURKB,CA12
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,RORC,KDM1A,ALOX15,CA7,YES1,TP53,CA2,XDH,POLB,MET,NPSR1,AURKB,CYP19A1,HSD17B10
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CDK1,RECQL,KDM1A,EGFR,CA12,AXL,SRC,KDR,CSNK2A2,TP53,NOX4,MET,ACHE,AURKB,HSD17B10
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,CA14,F2,CDK1,KDR,MET,CA4,ALOX12,ALOX5,ACHE,NPSR1,NOX4,XDH,ABCG2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,ALOX15,CA2,YES1,MET,ALOX12,ALOX5,RORC,TP53,NOX4,CYP1A2,XDH,CSNK2A3
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA4,CA2,MET,CDK1,SRC,CYP19A1,CA12,CA14,AXL,EGFR,KDR,IGF1R
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,CA12,CDK1,CA4,AURKB,NOX4,CYP19A1,CA12,CDK1,SRC,AURKB
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC,IGF1R,MET,CDK1,KDR,ALOX5,KDM1A,EGFR,FLT3,AXL
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	IGF1R,CDK1,SRC,CA4,ALOX12,ALOX5,TP53,NOX4,AURKB,CSNK2A3
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	NCT02337933
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	PIM1
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	NOX4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Phlomoides Hamosa

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

16 All known Ingredients in Total

8 Ingredients with Acceptable Bioavailablity

13 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Other specified malignant neoplasms of kidney, except renal pelvis

Acute myeloid leukaemia

Pheochromocytoma

Hepatoblastoma

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of adrenal gland

Malignant neoplasms of thyroid gland, unspecified

Glioblastoma of brain

Malignant haematopoietic neoplasm

Colorectal cancer

Malignant neoplasms of oesophagus

Renal cell carcinoma, chromophobe type

Liver cancer

Brain cancer

Ovarian cancer

Multiple myeloma

Myelodysplastic syndrome

COVID-19

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Cytomegaloviral disease

Malignant neoplasms of thymus

Head and neck cancer

Chronic kidney disease

Multiple sclerosis

Alzheimer disease

Pancreatic cancer

Bacterial infection

Peritoneal cancer

Melanoma

Renal cell carcinoma

Cardiovascular disease

Stomach cancer

Mature B-cell leukaemia

Rheumatoid arthritis

Glaucoma

Psoriasis

Malignant neoplasm metastasis in lymph nodes of head, face or neck

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Chikungunya virus disease

Non-small cell lung cancer

Seborrhoeic dermatitis

Asthma

Chronic arterial occlusive disease

Pain, unspecified

Type 2 diabetes mellitus

Nasopharyngeal cancer

Myeloproliferative neoplasm

Pleomorphic sarcoma

Chronic pain

Thrombocytopenia

Metastatic lymph node neoplasm

Prostate cancer

Adenocarcinoma of prostate

Melanoma of skin

Systemic lupus erythematosus

Invasive carcinoma of breast

Human immunodeficiency virus disease without mention of tuberculosis or malaria