• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Piper Aduncum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGATGCCTATCAAAAATAAGATAGACCAAAGTGAACTCGTAAACCCTCGTTATTGGCCCGCACGTCGGGGCGACGCCTTGCACGCGTCGGGCAACAACGAACCAAATATCGGCGCAGCACGCGCCAAGGAACTTTGAAAGTTTTGATCGCAGCCTCCTCCTCCCCATCGGGATGGAGGGGACGCATCAAACAGATACTAGTCTATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCTTTCGGTCGAGGGCACATCTGCTTGGGCGTTAAACAACTCGTCGCCCCCCACATTCTCTCCCCGCACTCCGACCAAGGAGAGCCCGGCAGAGAGGAGGGTAGGGTGGGCGGAGTCTGGTTGTCCGTGGGCCTACAGCGCACGCGGTTGGCTGAAAATATAGGGCCATGGGCTGTGTGCGGCTCAACAAGTGGTGGTTGTGCGCCCTAATAAAGGCCACGATTGTCAGCATGTTGCTCCCATCACTTCCCGATAGGCCCTGCAAGGACCCAACACAATCGAAACATCCAATCCACGGATCGATTCGAATTGCA

Click for details-----ITS1

TTGATGCCTATCAAAAATAAGATAGACCAAAGTGAACTCGTAAACCCTCGTTATTGGCCCGCACGTCGGGGCGACGCCTTGCACGCGTCGGGCAACAACGAACCAAATATCGGCGCAGCACGCGCCAAGGAACTTTGAAAGTTTTGATCGCAGCCTCCTCCTCCCCATCGGGATGGAGGGGACGCATCAAACAGATACTAGTCTATA

Click for details-----ITS2

AACTCGTCGCCCCCCACATTCTCTCCCCGCACTCCGACCAAGGAGAGCCCGGCAGAGAGGAGGGTAGGGTGGGCGGAGTCTGGTTGTCCGTGGGCCTACAGCGCACGCGGTTGGCTGAAAATATAGGGCCATGGGCTGTGTGCGGCTCAACAAGTGGTGGTTGTGCGCCCTAATAAAGGCCACGATTGTCAGCATGTTGCTCCCATCACTTCCCGATAGGCCCTGCAAGGACCCAACACAATCGAAACATCCAATCCACGGATCGATTCGAATTGCA
Taxonomic Information

Plant ID: NPO8059
Plant Latin Name: Piper Aduncum
Taxonomy Genus: Piper
Taxonomy Family: Piperaceae

Plant External Links:

NCBI TaxonomyDB: 130377
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92589

Ingredient ID: NPC82225

Ingredient ID: NPC5521

Ingredient ID: NPC484819

Ingredient ID: NPC297388

Ingredient ID: NPC294593

Ingredient ID: NPC283170

Ingredient ID: NPC25844

Ingredient ID: NPC2401

Ingredient ID: NPC237946

Ingredient ID: NPC228323

Ingredient ID: NPC222342

Ingredient ID: NPC21367

Ingredient ID: NPC194949

Ingredient ID: NPC159589