• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Curcuma Zedoaria


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTTGAGAGAGCATCATAGAATGATGGATGATTGTGAACGTGTGAACGTGACCCTTTCGTCAGCCCGCCCAACATGTTTGGTGGGCGATTGACCGTAGCTCGGTGCGATCGGCACTAAGGAACAACGAACTTGGAAGCAGAGGGCCCCTTAGCGTGAGCGGGGAGCCCAATGCGTCGGAGATTCTTTCTTCGGAATCAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTGTGGTCGAGGGCACGCCTGCTTGGGCGTCATGACGTTGTCGCTTTTGCTCCATGCTTTGTCGGCATTGAGTGAGCGCGGAAATTGGCCCCGTGTGCCCTCAGGCACAGTCGGTCGAAGAGGGGGTAGTCGGTAATCGTCGAGCACGATGGACGTTGGTCGTCGCGAGCGAGAACTGAACGTCGTCCTCGTCGTTTTCGGATGAGTCCTCAAGAGACCCTGTGTGATGATTGCGGAGTCGCGTGAAAGCGCCGCGTCAATCATTTGCGGCCCCAAGTCAGGC

Click for details-----ITS1

CATTGTTGAGAGAGCATATACAGAATGATGGATGATTGCGAACGTGTGAACGCGACCCTTTCGTTCGTCCGCCCGCCCATGTTGGTTGGTGGGCGATTGACCGTAGCTCGGTGCGATCGGCACTAAGGAACAACGAACTTGGAAGCAGAGGGCCCCCTTAGCGTGAGCGGGGAGCACGATGCGTCGGAGATTCTTCGGAATCAAA

Click for details-----ITS2

CGTTGTCGCTTTTGCTCCATGCTTCGTCGGCATTGAGCGCGGAAGTTGGCCCCGTGTGCCCTCGGACACAGTCGGTCGAAGAGTGGGTAGTCGGTAATCGTCGAGCACGATGGACGTTGGTCGTCGCGAGCGAGAACTGAACGTCGTCCTCGTCGTTTTGGGATGAGCCCTCAAGAAAGAGACCCTGCGTGATGATTGCGGAGTCGCGTGAAAGCGCCGCGTCAATCATTTGCGGCCCCAAGTCAGGC
Taxonomic Information

Plant ID: NPO7929
Plant Latin Name: Curcuma Zedoaria
Taxonomy Genus: Curcuma
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 136224
Plant-of-the-World-Online: 872393-1

Used in Medicines

Country/Region:
Brazil; Philippines; Indonesia; India; Malaysia; Vietnam; China; Laos; Thailand

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Brazil; Bangladesh; Myanmar; Trinidad and Tobago; Philippines; Indonesia; India; Cambodia; Malaysia; Vietnam; China; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

408 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


342 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

148 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99506

Ingredient ID: NPC99480

Ingredient ID: NPC99358

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC95969

Ingredient ID: NPC95675

Ingredient ID: NPC9424

Ingredient ID: NPC92839

Ingredient ID: NPC92676

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC90334

Ingredient ID: NPC89069

Ingredient ID: NPC88454

Ingredient ID: NPC88296

Ingredient ID: NPC86939

Ingredient ID: NPC86121

Ingredient ID: NPC85831

Ingredient ID: NPC85813

Ingredient ID: NPC83987

Ingredient ID: NPC81297

Ingredient ID: NPC80090

Ingredient ID: NPC8002

Ingredient ID: NPC78551

Ingredient ID: NPC78080

Ingredient ID: NPC77294

Ingredient ID: NPC77272

Ingredient ID: NPC76145

Ingredient ID: NPC75584

Ingredient ID: NPC75390

Ingredient ID: NPC75158

Ingredient ID: NPC75121

Ingredient ID: NPC7491

Ingredient ID: NPC74283

Ingredient ID: NPC74250

Ingredient ID: NPC7314

Ingredient ID: NPC72324

Ingredient ID: NPC71995

Ingredient ID: NPC71941

Ingredient ID: NPC71703

Ingredient ID: NPC71655

Ingredient ID: NPC71506

Ingredient ID: NPC7057

Ingredient ID: NPC70271

Ingredient ID: NPC70128

Ingredient ID: NPC69267

Ingredient ID: NPC68889

Ingredient ID: NPC6834

Ingredient ID: NPC68269

Ingredient ID: NPC67986

Ingredient ID: NPC66677

Ingredient ID: NPC66577

Ingredient ID: NPC65416

Ingredient ID: NPC64434

Ingredient ID: NPC6434

Ingredient ID: NPC64176

Ingredient ID: NPC63697

Ingredient ID: NPC61828

Ingredient ID: NPC61769

Ingredient ID: NPC61248

Ingredient ID: NPC61118

Ingredient ID: NPC60556

Ingredient ID: NPC58970

Ingredient ID: NPC58190

Ingredient ID: NPC57879

Ingredient ID: NPC57877

Ingredient ID: NPC55740

Ingredient ID: NPC54264

Ingredient ID: NPC53720

Ingredient ID: NPC52607

Ingredient ID: NPC52230

Ingredient ID: NPC51189

Ingredient ID: NPC49369

Ingredient ID: NPC48853

Ingredient ID: NPC481632

Ingredient ID: NPC46330

Ingredient ID: NPC45727

Ingredient ID: NPC45107

Ingredient ID: NPC44751

Ingredient ID: NPC43114

Ingredient ID: NPC42431

Ingredient ID: NPC42403

Ingredient ID: NPC424

Ingredient ID: NPC41385

Ingredient ID: NPC41348

Ingredient ID: NPC40821

Ingredient ID: NPC40249

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC34543

Ingredient ID: NPC327719

Ingredient ID: NPC32762

Ingredient ID: NPC327021

Ingredient ID: NPC324963

Ingredient ID: NPC32351

Ingredient ID: NPC321426

Ingredient ID: NPC317165

Ingredient ID: NPC312734

Ingredient ID: NPC312003

Ingredient ID: NPC310478

Ingredient ID: NPC310228

Ingredient ID: NPC309182

Ingredient ID: NPC308943

Ingredient ID: NPC308789

Ingredient ID: NPC30853

Ingredient ID: NPC308218

Ingredient ID: NPC308108

Ingredient ID: NPC307414

Ingredient ID: NPC307011

Ingredient ID: NPC305327

Ingredient ID: NPC304309

Ingredient ID: NPC304111

Ingredient ID: NPC303728

Ingredient ID: NPC302533

Ingredient ID: NPC301972

Ingredient ID: NPC301767

Ingredient ID: NPC300956

Ingredient ID: NPC300940

Ingredient ID: NPC30067

Ingredient ID: NPC300649

Ingredient ID: NPC29976

Ingredient ID: NPC299257

Ingredient ID: NPC298062

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC297422

Ingredient ID: NPC296337

Ingredient ID: NPC294548

Ingredient ID: NPC294196

Ingredient ID: NPC294136

Ingredient ID: NPC293746

Ingredient ID: NPC29154

Ingredient ID: NPC291233

Ingredient ID: NPC290923

Ingredient ID: NPC290613

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC290052

Ingredient ID: NPC29

Ingredient ID: NPC289827

Ingredient ID: NPC289593

Ingredient ID: NPC289366

Ingredient ID: NPC289120

Ingredient ID: NPC288932

Ingredient ID: NPC288168

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC286931

Ingredient ID: NPC286774

Ingredient ID: NPC286189

Ingredient ID: NPC285814

Ingredient ID: NPC285716

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC280965

Ingredient ID: NPC279364

Ingredient ID: NPC277917

Ingredient ID: NPC277736

Ingredient ID: NPC276697

Ingredient ID: NPC276218

Ingredient ID: NPC276060

Ingredient ID: NPC275472

Ingredient ID: NPC274584

Ingredient ID: NPC27396

Ingredient ID: NPC271321

Ingredient ID: NPC271122

Ingredient ID: NPC270406

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC267714

Ingredient ID: NPC265921

Ingredient ID: NPC26575

Ingredient ID: NPC265383

Ingredient ID: NPC264779

Ingredient ID: NPC264470

Ingredient ID: NPC261831

Ingredient ID: NPC260118

Ingredient ID: NPC259512

Ingredient ID: NPC259134

Ingredient ID: NPC258672

Ingredient ID: NPC257120

Ingredient ID: NPC256848

Ingredient ID: NPC254156

Ingredient ID: NPC253555

Ingredient ID: NPC252660

Ingredient ID: NPC252230

Ingredient ID: NPC251666

Ingredient ID: NPC249815

Ingredient ID: NPC248726

Ingredient ID: NPC248411

Ingredient ID: NPC24794

Ingredient ID: NPC247452

Ingredient ID: NPC246623

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC246125

Ingredient ID: NPC243351

Ingredient ID: NPC242314

Ingredient ID: NPC241180

Ingredient ID: NPC240817

Ingredient ID: NPC240267

Ingredient ID: NPC239531

Ingredient ID: NPC239037

Ingredient ID: NPC237837

Ingredient ID: NPC236495

Ingredient ID: NPC232375

Ingredient ID: NPC232226

Ingredient ID: NPC231738

Ingredient ID: NPC23049

Ingredient ID: NPC230301

Ingredient ID: NPC230291

Ingredient ID: NPC230070

Ingredient ID: NPC229886

Ingredient ID: NPC227670

Ingredient ID: NPC227442

Ingredient ID: NPC227378

Ingredient ID: NPC22678

Ingredient ID: NPC22484

Ingredient ID: NPC223558

Ingredient ID: NPC223062

Ingredient ID: NPC222997

Ingredient ID: NPC22229

Ingredient ID: NPC222210

Ingredient ID: NPC222175

Ingredient ID: NPC222001

Ingredient ID: NPC221698

Ingredient ID: NPC221164

Ingredient ID: NPC220860

Ingredient ID: NPC219400

Ingredient ID: NPC218918

Ingredient ID: NPC218163

Ingredient ID: NPC217394

Ingredient ID: NPC217226

Ingredient ID: NPC216735

Ingredient ID: NPC216630

Ingredient ID: NPC215747

Ingredient ID: NPC215632

Ingredient ID: NPC215215

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213903

Ingredient ID: NPC213749

Ingredient ID: NPC210831

Ingredient ID: NPC210288

Ingredient ID: NPC209970

Ingredient ID: NPC209275

Ingredient ID: NPC209182

Ingredient ID: NPC208926

Ingredient ID: NPC208764

Ingredient ID: NPC207383

Ingredient ID: NPC206975

Ingredient ID: NPC206132

Ingredient ID: NPC206007

Ingredient ID: NPC20562

Ingredient ID: NPC20410

Ingredient ID: NPC202850

Ingredient ID: NPC202744

Ingredient ID: NPC201567

Ingredient ID: NPC200718

Ingredient ID: NPC198685

Ingredient ID: NPC198023

Ingredient ID: NPC196924

Ingredient ID: NPC196592

Ingredient ID: NPC196490

Ingredient ID: NPC196334

Ingredient ID: NPC196212

Ingredient ID: NPC196081

Ingredient ID: NPC19582

Ingredient ID: NPC194774

Ingredient ID: NPC194681

Ingredient ID: NPC193180

Ingredient ID: NPC191765

Ingredient ID: NPC191658

Ingredient ID: NPC191498

Ingredient ID: NPC189853

Ingredient ID: NPC189844

Ingredient ID: NPC189036

Ingredient ID: NPC188693

Ingredient ID: NPC187625

Ingredient ID: NPC186905

Ingredient ID: NPC185816

Ingredient ID: NPC185438

Ingredient ID: NPC184831

Ingredient ID: NPC184671

Ingredient ID: NPC184049

Ingredient ID: NPC183670

Ingredient ID: NPC183180

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC180398

Ingredient ID: NPC180340

Ingredient ID: NPC179686

Ingredient ID: NPC179024

Ingredient ID: NPC178408

Ingredient ID: NPC178223

Ingredient ID: NPC177154

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC175987

Ingredient ID: NPC175913

Ingredient ID: NPC1748

Ingredient ID: NPC174213

Ingredient ID: NPC17408

Ingredient ID: NPC174006

Ingredient ID: NPC173996

Ingredient ID: NPC171874

Ingredient ID: NPC171736

Ingredient ID: NPC170799

Ingredient ID: NPC169303

Ingredient ID: NPC168855

Ingredient ID: NPC16802

Ingredient ID: NPC167159

Ingredient ID: NPC166894

Ingredient ID: NPC166553

Ingredient ID: NPC166362

Ingredient ID: NPC165967

Ingredient ID: NPC164792

Ingredient ID: NPC163984

Ingredient ID: NPC163866

Ingredient ID: NPC162742

Ingredient ID: NPC16157

Ingredient ID: NPC160900

Ingredient ID: NPC160416

Ingredient ID: NPC159754

Ingredient ID: NPC15592

Ingredient ID: NPC155182

Ingredient ID: NPC154932

Ingredient ID: NPC154493

Ingredient ID: NPC154186

Ingredient ID: NPC153602

Ingredient ID: NPC152989

Ingredient ID: NPC152964

Ingredient ID: NPC152017

Ingredient ID: NPC151759

Ingredient ID: NPC151330

Ingredient ID: NPC150713

Ingredient ID: NPC150643

Ingredient ID: NPC150329

Ingredient ID: NPC149184

Ingredient ID: NPC148951

Ingredient ID: NPC148303

Ingredient ID: NPC147656

Ingredient ID: NPC14682

Ingredient ID: NPC146197

Ingredient ID: NPC145865

Ingredient ID: NPC14576

Ingredient ID: NPC144561

Ingredient ID: NPC143639

Ingredient ID: NPC143095

Ingredient ID: NPC142791

Ingredient ID: NPC142759

Ingredient ID: NPC141777

Ingredient ID: NPC13999

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC136203

Ingredient ID: NPC135238

Ingredient ID: NPC13428

Ingredient ID: NPC133976

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC130193

Ingredient ID: NPC128263

Ingredient ID: NPC126819

Ingredient ID: NPC124876

Ingredient ID: NPC12463

Ingredient ID: NPC124289

Ingredient ID: NPC123965

Ingredient ID: NPC123536

Ingredient ID: NPC123229

Ingredient ID: NPC12269

Ingredient ID: NPC121854

Ingredient ID: NPC121636

Ingredient ID: NPC121635

Ingredient ID: NPC121373

Ingredient ID: NPC120926

Ingredient ID: NPC118047

Ingredient ID: NPC11707

Ingredient ID: NPC115719

Ingredient ID: NPC115441

Ingredient ID: NPC114992

Ingredient ID: NPC114396

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC113733

Ingredient ID: NPC112697

Ingredient ID: NPC112610

Ingredient ID: NPC110884

Ingredient ID: NPC109813

Ingredient ID: NPC109083

Ingredient ID: NPC108912

Ingredient ID: NPC107471

Ingredient ID: NPC106250

Ingredient ID: NPC105246

Ingredient ID: NPC103771

Ingredient ID: NPC102100

Ingredient ID: NPC102091

Ingredient ID: NPC10180

Ingredient ID: NPC101285

Ingredient ID: NPC100879

Ingredient ID: NPC100362