• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Peritassa Campestris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAGGCAGAACGACCCGTGGATCGTCTAGAACTTTACTCGAGGGGTGGGCCGTTGTGGTCCTCGCTCGTTTGCCCCGGGGTGGGGTTGCTGGTCAAGGCTGCACCCCCTCGCCGTGGGCGCAAACAACAAACCCCGGCGCAAATCGCGCCAAGGAATAAGGAAGAAAGACGTGATCCCTGGGTCCCGGAGACGGTGCACCTGGGATTGCGTTGTCGTTATCCAATTCGAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACGAAATGTCGCCAAACATCCCTCCACACCCGTTCTACGGGGAAGCATCGGGGGCTGGCGGATGTTGGCCTCCCGTGTGCAGTCGCTAACGGTTGGCCTAAAAGAGAGTCCCCCAGACGAGGTGGCCACGACAAGCGGTGGTTGAAAGCTTGTGTGCTCTACTCGAACACCGTCGTGGGCAAGCCTAGTCTAAAGGGGAAGCGGAAGGCCCTGACGCGGAGCGTCTCTCACACAGCGACC

Click for details-----ITS1

NA

Click for details-----ITS2

AATGTCGCCAAACATCCCTCCACACCCGTTCTACGGGGAAGCATCGGGGGCTGGCGGATGTTGGCCTCCCGTGTGCAGTCGCTAACGGTTGGCCTAAAAGAGAGTCCCCCAGACGAGGTGGCCACGACAAGCGGTGGTTGAAAGCTTGTGTGCTCTACTCGAACACCGTCGTGGGCAAGCCTAGTCTAAAGGGGAAGCGGAAGGCCCTGACGCGGAGCGTCTCTCACACAGCGACC
Taxonomic Information

Plant ID: NPO7869
Plant Latin Name: Peritassa Campestris
Taxonomy Genus: Peritassa
Taxonomy Family: Celastraceae

Plant External Links:

NCBI TaxonomyDB: 123445
Plant-of-the-World-Online: 190394-2

Used in Medicines

Unknown.

Geographical Distribution

Brazil; Paraguay

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

32 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC78540

Ingredient ID: NPC59436

Ingredient ID: NPC57797

Ingredient ID: NPC52

Ingredient ID: NPC44102

Ingredient ID: NPC32441

Ingredient ID: NPC324137

Ingredient ID: NPC312391

Ingredient ID: NPC307751

Ingredient ID: NPC278158

Ingredient ID: NPC267732

Ingredient ID: NPC259704

Ingredient ID: NPC241938

Ingredient ID: NPC237591

Ingredient ID: NPC230301

Ingredient ID: NPC228377

Ingredient ID: NPC220596

Ingredient ID: NPC219913

Ingredient ID: NPC20610

Ingredient ID: NPC203719

Ingredient ID: NPC194586

Ingredient ID: NPC194208

Ingredient ID: NPC191987

Ingredient ID: NPC190453

Ingredient ID: NPC166894

Ingredient ID: NPC152825

Ingredient ID: NPC143459

Ingredient ID: NPC129740

Ingredient ID: NPC129353

Ingredient ID: NPC128248

Ingredient ID: NPC120145

Ingredient ID: NPC118626

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 19 CYP19A1 Cytochrome P450 19A1 P11511 CHEMBL1978
Cytochrome P450 Cytochrome P450 family 2 CYP2C19 Cytochrome P450 2C19 P33261 CHEMBL3622
Therapeutic Target Enzyme KARS1 Lysyl-tRNA synthetase Q15046 CHEMBL5575
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Oxidoreductase CBR1 Carbonyl reductase [NADPH] 1 P16152 CHEMBL5586
Therapeutic Target Oxidoreductase XDH Xanthine dehydrogenase P47989 CHEMBL1929
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CA7,CYP1B1,DPP4,F2,XDH,CBR1,CYP2C19
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA4,CA12,CYP19A1,CA12,TRIM24,CYP19A1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA4,CA12,CA7,DPP4,CYP19A1,CBR1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,CA7,F2,XDH,CBR1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA12,CA7,DPP4,XDH,CBR1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,CYP1B1,CA7,DPP4,XDH
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CA7,F2,XDH,CBR1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA4,CA12,DPP4,F2,XDH
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA7,DPP4,CYP19A1,XDH
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 TRIM24,CA4,CA12,CYP19A1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,CYP1B1,DPP4,CYP19A1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA4,CA12,CYP19A1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CA12,CA4,XDH
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 CA4,F2,CBR1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,XDH,CYP1A2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 TRIM24,CA12,CBR1
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CYP19A1,XDH,F2
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 DPP4,CBR1,CYP19A1
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP1A1,F2,XDH
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 TRIM24,CYP1B1,DPP4
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12,CYP1A2,CYP1A1
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2,DPP4
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 DPP4,F2
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12,CA4
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA4,CA12
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 XDH,CA4
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 CYP19A1,F2
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA4,F2
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1,F2
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,XDH
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 DPP4,CA4
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP1A1,CYP2C19
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 CYP19A1,XDH
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,DPP4
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 F2
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 F2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 DPP4
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 DPP4
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 DPP4
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA4
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CA4
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 DPP4
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 DPP4
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group