• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Fritillaria Hupehensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGAGAACCGACCGAGAGACCGCGAACTCGTAAACGGATGACACCGTGTCGGGCGGGCACTATGCCCGCCCTGCGTGAACTCGCATCGTGCCTCTCCGGGCACGATTTGCGGGGGACGAACGAAACCCCGGCGTGGCCTGCGCCAAGGAACATATGACAGGACGGACGCACGTCAACGCCTCTGCGGCGGGGCGGCGTTCGCTCTCTTTCCATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCTTTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCTTGTTTCGCTCCGTGCCCAATGACCCTTCGGGTGCGGTCACGGATGCGGAGATTGGCCCCCCGTGCCTCGTGTGCGGCGGGCTTAAGCGCGGGCTGTCGGCGTCGGGATGGGCACGACGAGTGGTGGACGGAGCACCAGCAGGATGTTGTGGCCCCCTGTCGCCTTAAGGGGCTCAAGAGACCCGAACCGGGCGAGCCGTGCTCCGTACGAGGAGGGCGTGCCGTCTCGCA

Click for details-----ITS1

AAGGATCATTGTCGAGAACCGACCGAGAGACCGCGAACTCGTAAACGGATGACACCGTGTCGGGCGGGCACTATGCCCGCCCTGCGTGAACTCGCATCGTGCCTCTCCGGGCACGATTTGCGGGGGACGAACGAAACCCCGGCGTGGCCTGCGCCAAGGAACATATGACAGGACGGACGCACGTCAACGCCTCTGCGGCGGGGCGGCGTTCGCTCTCTTTCCATA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7844
Plant Latin Name: Fritillaria Hupehensis
Taxonomy Genus: Fritillaria
Taxonomy Family: Liliaceae

Plant External Links:

NCBI TaxonomyDB: 152089
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

103 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


69 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

37 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90701

Ingredient ID: NPC8821

Ingredient ID: NPC87828

Ingredient ID: NPC86947

Ingredient ID: NPC85270

Ingredient ID: NPC76145

Ingredient ID: NPC75097

Ingredient ID: NPC71339

Ingredient ID: NPC68204

Ingredient ID: NPC66913

Ingredient ID: NPC63027

Ingredient ID: NPC62086

Ingredient ID: NPC61198

Ingredient ID: NPC5952

Ingredient ID: NPC54320

Ingredient ID: NPC52370

Ingredient ID: NPC49074

Ingredient ID: NPC44611

Ingredient ID: NPC43246

Ingredient ID: NPC41080

Ingredient ID: NPC39333

Ingredient ID: NPC36490

Ingredient ID: NPC36002

Ingredient ID: NPC35344

Ingredient ID: NPC312637

Ingredient ID: NPC305224

Ingredient ID: NPC299964

Ingredient ID: NPC288411

Ingredient ID: NPC278525

Ingredient ID: NPC27699

Ingredient ID: NPC264779

Ingredient ID: NPC263034

Ingredient ID: NPC262431

Ingredient ID: NPC259976

Ingredient ID: NPC248520

Ingredient ID: NPC248047

Ingredient ID: NPC243728

Ingredient ID: NPC242582

Ingredient ID: NPC242385

Ingredient ID: NPC241055

Ingredient ID: NPC238829

Ingredient ID: NPC23733

Ingredient ID: NPC232924

Ingredient ID: NPC230301

Ingredient ID: NPC226879

Ingredient ID: NPC226803

Ingredient ID: NPC22481

Ingredient ID: NPC223951

Ingredient ID: NPC221134

Ingredient ID: NPC218988

Ingredient ID: NPC216216

Ingredient ID: NPC215158

Ingredient ID: NPC214251

Ingredient ID: NPC214237

Ingredient ID: NPC212875

Ingredient ID: NPC211722

Ingredient ID: NPC211608

Ingredient ID: NPC211342

Ingredient ID: NPC209011

Ingredient ID: NPC204050

Ingredient ID: NPC198865

Ingredient ID: NPC194677

Ingredient ID: NPC190036

Ingredient ID: NPC189719

Ingredient ID: NPC189470

Ingredient ID: NPC186944

Ingredient ID: NPC185072

Ingredient ID: NPC184615

Ingredient ID: NPC179024

Ingredient ID: NPC177465

Ingredient ID: NPC176740

Ingredient ID: NPC175313

Ingredient ID: NPC168829

Ingredient ID: NPC168409

Ingredient ID: NPC168255

Ingredient ID: NPC166963

Ingredient ID: NPC166097

Ingredient ID: NPC160913

Ingredient ID: NPC157927

Ingredient ID: NPC156461

Ingredient ID: NPC154920

Ingredient ID: NPC149700

Ingredient ID: NPC142632

Ingredient ID: NPC142400

Ingredient ID: NPC141777

Ingredient ID: NPC141003

Ingredient ID: NPC138466

Ingredient ID: NPC13789

Ingredient ID: NPC128494

Ingredient ID: NPC128457

Ingredient ID: NPC122792

Ingredient ID: NPC117862

Ingredient ID: NPC117527

Ingredient ID: NPC116628

Ingredient ID: NPC115119

Ingredient ID: NPC114526

Ingredient ID: NPC114239

Ingredient ID: NPC113650

Ingredient ID: NPC11358

Ingredient ID: NPC112355

Ingredient ID: NPC109813

Ingredient ID: NPC105255

Ingredient ID: NPC105004