• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sinapis Alba


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTATCCTGGAAACAGAACAACCCGAGAACAATGAAACATCACTCTCGGTGGGCCGGTTTCTTTGCTGATTCTGTGCCTGCCGATTCCGTGGTTATGCGTTAAGTTCCCAGCCAGTACTTCAGTCTTGGTTGGGTCTTGCGCATTGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATTCAACTAGGTAGCCTGCTTTCGCCAACCCGGAGACGGTGTTTGTGCGGAAGCTGTGCTCCAATGTAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTTTTGGAGCGTCTCGACATGCGGTGGTGAATTGTAACCTCGTCATATTGTCGGTCGTTCCGGTTCAAAAGCTCTTGATGACCCAAAGTCCTCAAC

Click for details-----ITS1

TCGTATCCTGGAAACAGAACAACCCGAGAACAATGAAACATCACTCTCGGTGGGCCGGTTTCTTTGCTGATTCTGTGCCTGCCGATTCCGTGGTTATGCGTTAAGTTCCCAGCCAGTACTTCGGTCTTGGTTGGGTCTTGCGCATTGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATTCAACTAGGTAGCCTGCGTTCGCCAACCCGGAGACGGTGTTTGTGCGGAAGCTGTGCTGCAATGTAAAGTCTAAAA

Click for details-----ITS2

ATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTTTTGGAGCGTCTCGACATGCGGTGGTGAATTGTAACCTCGTCATATTGTCGGTCGTTCCGGTTCAAAAGCTCTTGATGACCCAAAGTCCTCAAC
Taxonomic Information

Plant ID: NPO784
Plant Latin Name: Sinapis Alba
Taxonomy Genus: Sinapis
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3728
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Jordan; China; Lebanon; India

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda; Siddha


Medicinal Functions:

Antibacterial; Antifungal; Antirheumatic; Appetizer; Carminative; Cathartic; Diaphoretic; Digestive; Diuretic; Emetic; Expectorant; Rubefacient; Stimulant; Vesicant

Geographical Distribution

Lebanon; India; Jordan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

238 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


176 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

134 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98386

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93617

Ingredient ID: NPC89778

Ingredient ID: NPC89042

Ingredient ID: NPC86371

Ingredient ID: NPC85813

Ingredient ID: NPC84585

Ingredient ID: NPC80989

Ingredient ID: NPC80841

Ingredient ID: NPC80710

Ingredient ID: NPC78540

Ingredient ID: NPC75611

Ingredient ID: NPC73584

Ingredient ID: NPC7208

Ingredient ID: NPC71726

Ingredient ID: NPC71375

Ingredient ID: NPC6717

Ingredient ID: NPC6516

Ingredient ID: NPC64663

Ingredient ID: NPC62045

Ingredient ID: NPC61477

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC55412

Ingredient ID: NPC50898

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489910

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC4812

Ingredient ID: NPC46715

Ingredient ID: NPC45780

Ingredient ID: NPC43143

Ingredient ID: NPC42716

Ingredient ID: NPC41240

Ingredient ID: NPC35544

Ingredient ID: NPC35446

Ingredient ID: NPC34981

Ingredient ID: NPC34908

Ingredient ID: NPC328447

Ingredient ID: NPC32641

Ingredient ID: NPC317120

Ingredient ID: NPC31643

Ingredient ID: NPC315296

Ingredient ID: NPC313955

Ingredient ID: NPC313182

Ingredient ID: NPC313032

Ingredient ID: NPC308472

Ingredient ID: NPC30720

Ingredient ID: NPC305858

Ingredient ID: NPC302003

Ingredient ID: NPC297186

Ingredient ID: NPC297026

Ingredient ID: NPC29601

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC29391

Ingredient ID: NPC293628

Ingredient ID: NPC291796

Ingredient ID: NPC291473

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289536

Ingredient ID: NPC287350

Ingredient ID: NPC285322

Ingredient ID: NPC284386

Ingredient ID: NPC284339

Ingredient ID: NPC281972

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC279668

Ingredient ID: NPC279121

Ingredient ID: NPC277532

Ingredient ID: NPC27723

Ingredient ID: NPC273330

Ingredient ID: NPC272614

Ingredient ID: NPC27225

Ingredient ID: NPC271708

Ingredient ID: NPC270456

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC2660

Ingredient ID: NPC263821

Ingredient ID: NPC262827

Ingredient ID: NPC262435

Ingredient ID: NPC261831

Ingredient ID: NPC258867

Ingredient ID: NPC258575

Ingredient ID: NPC258035

Ingredient ID: NPC254482

Ingredient ID: NPC253788

Ingredient ID: NPC253336

Ingredient ID: NPC251860

Ingredient ID: NPC250406

Ingredient ID: NPC245346

Ingredient ID: NPC245027

Ingredient ID: NPC244738

Ingredient ID: NPC243083

Ingredient ID: NPC242580

Ingredient ID: NPC240306

Ingredient ID: NPC237812

Ingredient ID: NPC234560

Ingredient ID: NPC234051

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC226333

Ingredient ID: NPC226265

Ingredient ID: NPC226027

Ingredient ID: NPC225851

Ingredient ID: NPC225710

Ingredient ID: NPC222342

Ingredient ID: NPC221466

Ingredient ID: NPC219876

Ingredient ID: NPC219870

Ingredient ID: NPC219143

Ingredient ID: NPC217226

Ingredient ID: NPC216127

Ingredient ID: NPC213876

Ingredient ID: NPC213412

Ingredient ID: NPC21290

Ingredient ID: NPC210886

Ingredient ID: NPC210001

Ingredient ID: NPC209560

Ingredient ID: NPC209550

Ingredient ID: NPC209111

Ingredient ID: NPC208793

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC207744

Ingredient ID: NPC203468

Ingredient ID: NPC203440

Ingredient ID: NPC202856

Ingredient ID: NPC202116

Ingredient ID: NPC201844

Ingredient ID: NPC197376

Ingredient ID: NPC196753

Ingredient ID: NPC196676

Ingredient ID: NPC194857

Ingredient ID: NPC193989

Ingredient ID: NPC192421

Ingredient ID: NPC19174

Ingredient ID: NPC188867

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC185249

Ingredient ID: NPC184151

Ingredient ID: NPC181124

Ingredient ID: NPC180279

Ingredient ID: NPC179860

Ingredient ID: NPC17810

Ingredient ID: NPC176348

Ingredient ID: NPC176017

Ingredient ID: NPC175429

Ingredient ID: NPC174246

Ingredient ID: NPC17322

Ingredient ID: NPC173003

Ingredient ID: NPC17151

Ingredient ID: NPC170739

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164487

Ingredient ID: NPC162620

Ingredient ID: NPC162282

Ingredient ID: NPC160179

Ingredient ID: NPC158404

Ingredient ID: NPC15698

Ingredient ID: NPC15658

Ingredient ID: NPC156457

Ingredient ID: NPC156139

Ingredient ID: NPC155481

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152452

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC150648

Ingredient ID: NPC149803

Ingredient ID: NPC149494

Ingredient ID: NPC149155

Ingredient ID: NPC147983

Ingredient ID: NPC147686

Ingredient ID: NPC144939

Ingredient ID: NPC143427

Ingredient ID: NPC142142

Ingredient ID: NPC139364

Ingredient ID: NPC138994

Ingredient ID: NPC138990

Ingredient ID: NPC137958

Ingredient ID: NPC13771

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC133836

Ingredient ID: NPC132307

Ingredient ID: NPC130683

Ingredient ID: NPC130341

Ingredient ID: NPC129682

Ingredient ID: NPC128678

Ingredient ID: NPC126925

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC126250

Ingredient ID: NPC125062

Ingredient ID: NPC124436

Ingredient ID: NPC123304

Ingredient ID: NPC122493

Ingredient ID: NPC122470

Ingredient ID: NPC121703

Ingredient ID: NPC120649

Ingredient ID: NPC12013

Ingredient ID: NPC116775

Ingredient ID: NPC116709

Ingredient ID: NPC116593

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112889

Ingredient ID: NPC110533

Ingredient ID: NPC108897

Ingredient ID: NPC108358

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC107373

Ingredient ID: NPC107161

Ingredient ID: NPC106551

Ingredient ID: NPC106439

Ingredient ID: NPC106197

Ingredient ID: NPC102832

Ingredient ID: NPC100284