• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Coprosma Lucida


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAAACGACCGCGAACAAGTTCATAAACTGACCGGGCGACGGCGATAGGGGGCCACCCCGTTCGCACGACCCCGGACCCAACTAAACTCCCGGCGCGGAAAGCGCCAAGGACTACTCAAACGGATTGCCCGTTTCCCTTGCGGGTTCCGCGAGGGAGGCGTCGGCGTCTGAAACGTAACCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGTCACCCGCACTCGTCGAGTTCGGGAGACGGATGTTGGCCTCCCGTGCCCTTGCGGTGCGGCCGGCCTAAATGCGAGTCCTCGGCTCGGGACGTCACGACAAGTGGTGGTTGAACTCCTCAACTCGTTTGCTGTCTTGACGACGCCCGTCGCCGGTGAACGGCTCGATCGACCCAAGAGCCCCGAAACGGGCCTTCGACC

Click for details-----ITS1

TCGAATCCTGCAAACGACCGCGAACAAGTTCATAAACTGACCGGGCGACGGCGATAGGGGGCCACCCCGTTCGCACGACCCCGGACCCAACTAAACTCCCGGCGCGGAAAGCGCCAAGGACTACTCAAACGGATTGCCCGTTTCCCTTGCGGGTTCCGCGAGGGAGGCGTCGGCGTCTGAAACGTAACCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7749
Plant Latin Name: Coprosma Lucida
Taxonomy Genus: Coprosma
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 651545
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9432

Ingredient ID: NPC81010

Ingredient ID: NPC70799

Ingredient ID: NPC42251

Ingredient ID: NPC34864

Ingredient ID: NPC29883

Ingredient ID: NPC291516

Ingredient ID: NPC209660

Ingredient ID: NPC198141

Ingredient ID: NPC161571

Ingredient ID: NPC145145

Ingredient ID: NPC114392

Ingredient ID: NPC113831