• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Elettaria Cardamomum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTTGAGAGAGCATTGAATGATGGATGGTTGTGAATGTGTCAACGCGCCCTTCCTTGCCCTATGTTGGTGGGCAATTGATCGTAGCTCGGTGCGATCGGCACCAAGGAACAACGAACTTAGATGCAGAGGGCCCTCGATGTGCGCGGGGAGCTCAATGCGTCGGAGATGCCTCATAATCAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCTCGTGAACCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTGTGGCCGAGGGCACGCCTGCTTGGGCGTCATGGCATCGTCGCCTTTGCTCCTTGCTTTTGCTGGTGCCAAGCGCGGAAATTGGCCTCTTGTGCCCTCGGGCACAGTCGGTTGAAGAGTGGGTAGTCCGCAGTCGTCGGGCGCGATAGGTGTTGGTCGCCTTGTGCGTGAACTGATCGTCGTCCCCGTCGTGTTGGGATGAGTCCTCAAGAGACCCTGTGTGAATATGGCGTCGCATGAAAGCGCCATGTCCGTCATATTGTGGCCCCAAGTC

Click for details-----ITS1

CATTGTTGAGAGAGCATTGAATGATGGATGGTTGTGAATGTGTCAACGCGCCCTTCCTTGCCCTATGTTGGTGGGCAATTGATCGTAGCTCGGTGCGATCGGCACCAAGGAACAACGAACTTAGATGCAGAGGGCCCTCGATGTGCGCGGGGAGCTCAATGCGTCGGAGATGCCTCATAATCAAA

Click for details-----ITS2

CATCGTCGCCTTTGCTCCTTGCTTTTGCTGGTGCCAAGCGCGGTAATTGGCCTCTTGTGCCCTCGGGCACAGTCGGTTGAAGAGTGGGTAGTCCGCAGTCGTCGAGCGCGATAGGTGTTGGTCGCCTTGTGCGTGAACTGATCGTCGTCCGCGTCGTGTTGGGATGAGTCCTCAAGAGACCGTGTGTGAATATGGGGTCGCATGAAAGCGCCATGTCCGTCATATTGTGGTCCCAAGTCAGGCGAGGCCCACCCGCCGAGTATAAGCAT
Taxonomic Information

Plant ID: NPO7698
Plant Latin Name: Elettaria Cardamomum
Taxonomy Genus: Elettaria
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 105181
Plant-of-the-World-Online: 796556-1

Used in Medicines

Country/Region:
Thailand; Indonesia; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Indonesia; India; Costa Rica; Cambodia; Trinidad and Tobago; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

320 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


265 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

157 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC9880

Ingredient ID: NPC97192

Ingredient ID: NPC96630

Ingredient ID: NPC96115

Ingredient ID: NPC95676

Ingredient ID: NPC95675

Ingredient ID: NPC94850

Ingredient ID: NPC94304

Ingredient ID: NPC94218

Ingredient ID: NPC94167

Ingredient ID: NPC94045

Ingredient ID: NPC93843

Ingredient ID: NPC93033

Ingredient ID: NPC91574

Ingredient ID: NPC90787

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC86939

Ingredient ID: NPC85813

Ingredient ID: NPC85327

Ingredient ID: NPC84325

Ingredient ID: NPC83088

Ingredient ID: NPC82843

Ingredient ID: NPC82648

Ingredient ID: NPC82363

Ingredient ID: NPC8210

Ingredient ID: NPC81010

Ingredient ID: NPC79858

Ingredient ID: NPC79527

Ingredient ID: NPC78990

Ingredient ID: NPC78551

Ingredient ID: NPC78540

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC69928

Ingredient ID: NPC68889

Ingredient ID: NPC68873

Ingredient ID: NPC67986

Ingredient ID: NPC67761

Ingredient ID: NPC66681

Ingredient ID: NPC66577

Ingredient ID: NPC64176

Ingredient ID: NPC62086

Ingredient ID: NPC61066

Ingredient ID: NPC60556

Ingredient ID: NPC59815

Ingredient ID: NPC58970

Ingredient ID: NPC5708

Ingredient ID: NPC54264

Ingredient ID: NPC51758

Ingredient ID: NPC49074

Ingredient ID: NPC489907

Ingredient ID: NPC4827

Ingredient ID: NPC47946

Ingredient ID: NPC46705

Ingredient ID: NPC45727

Ingredient ID: NPC45540

Ingredient ID: NPC44751

Ingredient ID: NPC43860

Ingredient ID: NPC43728

Ingredient ID: NPC424

Ingredient ID: NPC41865

Ingredient ID: NPC41326

Ingredient ID: NPC4125

Ingredient ID: NPC41180

Ingredient ID: NPC40249

Ingredient ID: NPC3945

Ingredient ID: NPC3922

Ingredient ID: NPC38977

Ingredient ID: NPC3857

Ingredient ID: NPC38497

Ingredient ID: NPC37947

Ingredient ID: NPC3649

Ingredient ID: NPC36061

Ingredient ID: NPC34764

Ingredient ID: NPC3285

Ingredient ID: NPC3190

Ingredient ID: NPC3155

Ingredient ID: NPC312855

Ingredient ID: NPC312391

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC307011

Ingredient ID: NPC306616

Ingredient ID: NPC304927

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC30101

Ingredient ID: NPC300623

Ingredient ID: NPC300326

Ingredient ID: NPC29988

Ingredient ID: NPC29976

Ingredient ID: NPC299529

Ingredient ID: NPC297844

Ingredient ID: NPC297643

Ingredient ID: NPC297527

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC292792

Ingredient ID: NPC292092

Ingredient ID: NPC29091

Ingredient ID: NPC290582

Ingredient ID: NPC290078

Ingredient ID: NPC289974

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC284731

Ingredient ID: NPC284295

Ingredient ID: NPC283703

Ingredient ID: NPC283655

Ingredient ID: NPC282305

Ingredient ID: NPC281994

Ingredient ID: NPC279026

Ingredient ID: NPC277907

Ingredient ID: NPC277704

Ingredient ID: NPC276449

Ingredient ID: NPC276009

Ingredient ID: NPC275706

Ingredient ID: NPC274681

Ingredient ID: NPC273620

Ingredient ID: NPC27184

Ingredient ID: NPC270074

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269806

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268087

Ingredient ID: NPC266021

Ingredient ID: NPC26600

Ingredient ID: NPC26583

Ingredient ID: NPC265513

Ingredient ID: NPC261831

Ingredient ID: NPC26111

Ingredient ID: NPC259512

Ingredient ID: NPC258723

Ingredient ID: NPC257522

Ingredient ID: NPC257124

Ingredient ID: NPC256186

Ingredient ID: NPC255577

Ingredient ID: NPC255042

Ingredient ID: NPC254196

Ingredient ID: NPC25314

Ingredient ID: NPC25275

Ingredient ID: NPC252230

Ingredient ID: NPC252067

Ingredient ID: NPC249018

Ingredient ID: NPC24824

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC243601

Ingredient ID: NPC2426

Ingredient ID: NPC240817

Ingredient ID: NPC239039

Ingredient ID: NPC235260

Ingredient ID: NPC235059

Ingredient ID: NPC232375

Ingredient ID: NPC231988

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC229403

Ingredient ID: NPC229262

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC225406

Ingredient ID: NPC225284

Ingredient ID: NPC223417

Ingredient ID: NPC22229

Ingredient ID: NPC22098

Ingredient ID: NPC219573

Ingredient ID: NPC217748

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC2162

Ingredient ID: NPC215894

Ingredient ID: NPC21581

Ingredient ID: NPC215702

Ingredient ID: NPC215632

Ingredient ID: NPC214691

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC213380

Ingredient ID: NPC213322

Ingredient ID: NPC210831

Ingredient ID: NPC210560

Ingredient ID: NPC210316

Ingredient ID: NPC209970

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC20892

Ingredient ID: NPC208764

Ingredient ID: NPC207869

Ingredient ID: NPC206380

Ingredient ID: NPC202691

Ingredient ID: NPC202348

Ingredient ID: NPC201844

Ingredient ID: NPC19951

Ingredient ID: NPC198658

Ingredient ID: NPC197378

Ingredient ID: NPC196711

Ingredient ID: NPC196490

Ingredient ID: NPC195246

Ingredient ID: NPC194586

Ingredient ID: NPC194383

Ingredient ID: NPC19319

Ingredient ID: NPC193180

Ingredient ID: NPC190810

Ingredient ID: NPC190771

Ingredient ID: NPC19003

Ingredient ID: NPC189853

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187770

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC181582

Ingredient ID: NPC181153

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC180612

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC175987

Ingredient ID: NPC17458

Ingredient ID: NPC173996

Ingredient ID: NPC173658

Ingredient ID: NPC170070

Ingredient ID: NPC168518

Ingredient ID: NPC168351

Ingredient ID: NPC167990

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166553

Ingredient ID: NPC166362

Ingredient ID: NPC165808

Ingredient ID: NPC165651

Ingredient ID: NPC1656

Ingredient ID: NPC165525

Ingredient ID: NPC164646

Ingredient ID: NPC163984

Ingredient ID: NPC163424

Ingredient ID: NPC160996

Ingredient ID: NPC15912

Ingredient ID: NPC157923

Ingredient ID: NPC156654

Ingredient ID: NPC154480

Ingredient ID: NPC154186

Ingredient ID: NPC154172

Ingredient ID: NPC15292

Ingredient ID: NPC152438

Ingredient ID: NPC151140

Ingredient ID: NPC150950

Ingredient ID: NPC150713

Ingredient ID: NPC150329

Ingredient ID: NPC149570

Ingredient ID: NPC149209

Ingredient ID: NPC149203

Ingredient ID: NPC149184

Ingredient ID: NPC148677

Ingredient ID: NPC148216

Ingredient ID: NPC148163

Ingredient ID: NPC14682

Ingredient ID: NPC146197

Ingredient ID: NPC146104

Ingredient ID: NPC145304

Ingredient ID: NPC144561

Ingredient ID: NPC14426

Ingredient ID: NPC144223

Ingredient ID: NPC142871

Ingredient ID: NPC141777

Ingredient ID: NPC141699

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139065

Ingredient ID: NPC13826

Ingredient ID: NPC138113

Ingredient ID: NPC135257

Ingredient ID: NPC133097

Ingredient ID: NPC13199

Ingredient ID: NPC131981

Ingredient ID: NPC131431

Ingredient ID: NPC130209

Ingredient ID: NPC127447

Ingredient ID: NPC126393

Ingredient ID: NPC126240

Ingredient ID: NPC125962

Ingredient ID: NPC125085

Ingredient ID: NPC124436

Ingredient ID: NPC12319

Ingredient ID: NPC122768

Ingredient ID: NPC121373

Ingredient ID: NPC12137

Ingredient ID: NPC121270

Ingredient ID: NPC120867

Ingredient ID: NPC119090

Ingredient ID: NPC118561

Ingredient ID: NPC115284

Ingredient ID: NPC11489

Ingredient ID: NPC114667

Ingredient ID: NPC114239

Ingredient ID: NPC112945

Ingredient ID: NPC109813

Ingredient ID: NPC10908

Ingredient ID: NPC108952

Ingredient ID: NPC108494

Ingredient ID: NPC107540

Ingredient ID: NPC105780

Ingredient ID: NPC105380

Ingredient ID: NPC104195

Ingredient ID: NPC103700

Ingredient ID: NPC103213

Ingredient ID: NPC100445

Ingredient ID: NPC100362

Ingredient ID: NPC100178