• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Holarrhena Pubescens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGGAGCCTACCGAAAAAAAGACTTGCGAACGCGTTCATCATCGGGCGTCGGGGTGATTCCCGCGCGCGTGCCCCGCCGGCCGGTCGGTGCCTTCCCGGCTCCCGACTGTGCCAGACAACCAAAAACCAGCGCGGAAAGCGCCAAGGACTAGAAAACAGAATGCCTTCCTCCTGCTCGGCCGGCCGTTCGCGGCGCGGGTCGCGGGAGAGAAGGCTTCGTTCGAATCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCATTGCCGCCTTTGCTCCATGCGATGCTGGTGCTGAGCGCGTAAATTGGCCCCGTGTGCCCTCCTCCTCGGGCGGGCACAGTCGGTCGAAGAGCGGGTAGTCCCAAGTCGTCGGGCACGATGGGTGTTGGTCGCCACGAGCGGGAACCGAACATCGTCCTCGTCGTTTTGGGCTGAGCCCTCAATTCAAGGAAGAAAGAAGACCCTGTGTGATTTGATTGCGGCGGCGGGCGAAAGTGCCACGTCGTCCGTCCATCAATCAAC

Click for details-----ITS1

TCGGAGCCTACCGAAAAAAAGACTTGCGAACGCGTTCATCATCGGGCGTCGGGGTGATTCCCGCGCGCGTGCCCCGCCGGCCGGTCGGTGCCTTCCCGGCTCCCGACTGTGCCAGACAACCAAAAACCAGCGCGGAAAGCGCCAAGGACTAGAAAACAGAATGCCTTCCTCCTGCTCGGCCGGCCGTTCGCGGCGCGGGTCGCGGGAGAGAAGGCTTCGTTCGAATCTAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCGCACGCCTCGCCCCGAACGGGACGACGGTCGCGCACGGGGGCGGAAAATGGCCTCCCGTACTCTGCTTGCGGTTGGCCCAAACCCGAGTCCCTCTCGTCACGGACGTCACGACAAGTGGTAGCAGAAACCTCGAACTCGAACGCGAGTCGTGCGCACCTCGTGGCCGAGGAGACCCTTAGACCCTACGCTGAGTCCCTCTCCGGGGACGCTCGCAACGA
Taxonomic Information

Plant ID: NPO765
Plant Latin Name: Holarrhena Pubescens
Taxonomy Genus: Holarrhena
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 69381
Plant-of-the-World-Online: 79318-1

Used in Medicines

Country/Region:
Madagascar; Angola; South Africa; Tanzania; Vietnam; India; Laos; Zimbabwe; Rwanda; Swaziland; Thailand; Kenya; China

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Madagascar; Bangladesh; Nepal; Cambodia; Rwanda; Swaziland; Laos; Malawi; Zambia; Zimbabwe; China; Thailand; Tanzania; Mauritius; Vietnam; Pakistan; Angola; Myanmar; South Africa; India; Mozambique; Kenya; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


104 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

15 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95639

Ingredient ID: NPC91411

Ingredient ID: NPC89872

Ingredient ID: NPC8771

Ingredient ID: NPC87590

Ingredient ID: NPC86906

Ingredient ID: NPC86818

Ingredient ID: NPC85651

Ingredient ID: NPC82989

Ingredient ID: NPC82329

Ingredient ID: NPC80436

Ingredient ID: NPC79724

Ingredient ID: NPC74856

Ingredient ID: NPC7214

Ingredient ID: NPC69144

Ingredient ID: NPC67816

Ingredient ID: NPC64246

Ingredient ID: NPC60657

Ingredient ID: NPC60372

Ingredient ID: NPC58208

Ingredient ID: NPC54283

Ingredient ID: NPC53509

Ingredient ID: NPC49653

Ingredient ID: NPC49070

Ingredient ID: NPC48660

Ingredient ID: NPC46915

Ingredient ID: NPC45267

Ingredient ID: NPC4230

Ingredient ID: NPC40174

Ingredient ID: NPC36429

Ingredient ID: NPC36266

Ingredient ID: NPC354

Ingredient ID: NPC34884

Ingredient ID: NPC33513

Ingredient ID: NPC32905

Ingredient ID: NPC325330

Ingredient ID: NPC315745

Ingredient ID: NPC314102

Ingredient ID: NPC306882

Ingredient ID: NPC306592

Ingredient ID: NPC306581

Ingredient ID: NPC306541

Ingredient ID: NPC306286

Ingredient ID: NPC305201

Ingredient ID: NPC305100

Ingredient ID: NPC30489

Ingredient ID: NPC300241

Ingredient ID: NPC299889

Ingredient ID: NPC298916

Ingredient ID: NPC298791

Ingredient ID: NPC293776

Ingredient ID: NPC291722

Ingredient ID: NPC28678

Ingredient ID: NPC284838

Ingredient ID: NPC283277

Ingredient ID: NPC280090

Ingredient ID: NPC279514

Ingredient ID: NPC274505

Ingredient ID: NPC271648

Ingredient ID: NPC270275

Ingredient ID: NPC266116

Ingredient ID: NPC262372

Ingredient ID: NPC26181

Ingredient ID: NPC26176

Ingredient ID: NPC258693

Ingredient ID: NPC254421

Ingredient ID: NPC250498

Ingredient ID: NPC248058

Ingredient ID: NPC24733

Ingredient ID: NPC244968

Ingredient ID: NPC244582

Ingredient ID: NPC243935

Ingredient ID: NPC239126

Ingredient ID: NPC233489

Ingredient ID: NPC233256

Ingredient ID: NPC232365

Ingredient ID: NPC231590

Ingredient ID: NPC229215

Ingredient ID: NPC22771

Ingredient ID: NPC226850

Ingredient ID: NPC220949

Ingredient ID: NPC220771

Ingredient ID: NPC219768

Ingredient ID: NPC218180

Ingredient ID: NPC217788

Ingredient ID: NPC21773

Ingredient ID: NPC217129

Ingredient ID: NPC216693

Ingredient ID: NPC21543

Ingredient ID: NPC213631

Ingredient ID: NPC208580

Ingredient ID: NPC208568

Ingredient ID: NPC208343

Ingredient ID: NPC200794

Ingredient ID: NPC197292

Ingredient ID: NPC196134

Ingredient ID: NPC195456

Ingredient ID: NPC194435

Ingredient ID: NPC192432

Ingredient ID: NPC191948

Ingredient ID: NPC18509

Ingredient ID: NPC182962

Ingredient ID: NPC178831

Ingredient ID: NPC172931

Ingredient ID: NPC169375

Ingredient ID: NPC168551

Ingredient ID: NPC164973

Ingredient ID: NPC163329

Ingredient ID: NPC161102

Ingredient ID: NPC16017

Ingredient ID: NPC158755

Ingredient ID: NPC158162

Ingredient ID: NPC158032

Ingredient ID: NPC156800

Ingredient ID: NPC154397

Ingredient ID: NPC152829

Ingredient ID: NPC15264

Ingredient ID: NPC152353

Ingredient ID: NPC152039

Ingredient ID: NPC149281

Ingredient ID: NPC148164

Ingredient ID: NPC145773

Ingredient ID: NPC14522

Ingredient ID: NPC142774

Ingredient ID: NPC140419

Ingredient ID: NPC134847

Ingredient ID: NPC129732

Ingredient ID: NPC127780

Ingredient ID: NPC126817

Ingredient ID: NPC12578

Ingredient ID: NPC123800

Ingredient ID: NPC121855

Ingredient ID: NPC120458

Ingredient ID: NPC118329

Ingredient ID: NPC116350

Ingredient ID: NPC116123

Ingredient ID: NPC115687

Ingredient ID: NPC115311

Ingredient ID: NPC113405

Ingredient ID: NPC109268

Ingredient ID: NPC108040

Ingredient ID: NPC107178

Ingredient ID: NPC105504

Ingredient ID: NPC1041

Ingredient ID: NPC103593

Ingredient ID: NPC102622

Ingredient ID: NPC101042