• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Glycine Max


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGATCATTGTCGATGCCTCACAATCAGATTGACCCGCGAACTTGTTTATTCATCTACCGTCGGGAGGGAGGGGATGACCACGGCGCCCCGTGCGCCCGGCCTCCTCGTCCTCGCGACAAACACAAACCCCGGCGCTTCGTGCGCCAAGGAACTCAAATCTGTTAAGTGCGACTCCCGGGGGCCCGGAGACGGTGTCCCGCGGGAGTCGTCACGACACAACATTTACATACAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTTCCCCAACGCAAACATGTAACAATGTTGCTGCGCGGGGTGTATGCTGACCTCCCGCGAGCACCCGCCTCGTGGTTGGTTGAAATCTGGGTTCATGGCCGACTTCGCCGTGATAAAATGGTGGATGAGCCACGCTCGAGACCAATCACGTGCGAGCCGGTCAGTTCTGGACCCATCGACGACCCTTTGCGTGCACGCACGCTCCCAACGAGACCTCAGGTCA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTTCCCCAACGCAAACATGTAACAATGTTGTGCGCGGGGAGTATGCTGACCTCCCGCGAGCACCCGCCTCGTGGTTGGTTGAAATCTGGGTTCATGGCCGACTTCGCCGTGATAAAATGGTGGATGAGCCACGCTCGAGACCAATTACGTGCGAGCCGGTCAGTTCTGGACCCATCGACGACCCTTTGTGCACGCACGCTCCCA
Taxonomic Information

Plant ID: NPO7635
Plant Latin Name: Glycine Max
Taxonomy Genus: Glycine
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3847
Plant-of-the-World-Online: 60450240-2

Used in Medicines

Country/Region:
Canada; Brazil; Philippines; Indonesia; India; United States; China; Thailand; South Korea

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Antidote; Astringent; Diaphoretic; Laxative; Ophthalmic; Resolvent; Stomachic

Geographical Distribution

Brazil; Canada; Bangladesh; Guinea; Nepal; Cambodia; Ethiopia; Tanzania; Laos; Cameroon; Ecuador; Benin; Belarus; Cuba; China; Vietnam; Thailand; Dominican Republic; Iraq; Kazakhstan; Taiwan; Ukraine; Philippines; Indonesia; Turkmenistan; New Caledonia; United States; Trinidad and Tobago; Australia; Mongolia; Kenya; Russia; Pakistan; Honduras; Myanmar; Chad; South Africa; India; Uzbekistan; Congo; Colombia; Sri Lanka; Japan; South Korea; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

274 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


162 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

132 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95495

Ingredient ID: NPC9430

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90489

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC85346

Ingredient ID: NPC82241

Ingredient ID: NPC81010

Ingredient ID: NPC77916

Ingredient ID: NPC77272

Ingredient ID: NPC76176

Ingredient ID: NPC74590

Ingredient ID: NPC74119

Ingredient ID: NPC72402

Ingredient ID: NPC70744

Ingredient ID: NPC69445

Ingredient ID: NPC68779

Ingredient ID: NPC6616

Ingredient ID: NPC62045

Ingredient ID: NPC61989

Ingredient ID: NPC6095

Ingredient ID: NPC6072

Ingredient ID: NPC60151

Ingredient ID: NPC601

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC54733

Ingredient ID: NPC52900

Ingredient ID: NPC51581

Ingredient ID: NPC50934

Ingredient ID: NPC50898

Ingredient ID: NPC49896

Ingredient ID: NPC491304

Ingredient ID: NPC491218

Ingredient ID: NPC491217

Ingredient ID: NPC490504

Ingredient ID: NPC490433

Ingredient ID: NPC490424

Ingredient ID: NPC490398

Ingredient ID: NPC490397

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC490214

Ingredient ID: NPC490158

Ingredient ID: NPC490009

Ingredient ID: NPC489910

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489899

Ingredient ID: NPC489882

Ingredient ID: NPC48623

Ingredient ID: NPC47801

Ingredient ID: NPC46274

Ingredient ID: NPC424

Ingredient ID: NPC41326

Ingredient ID: NPC39620

Ingredient ID: NPC39426

Ingredient ID: NPC38069

Ingredient ID: NPC37793

Ingredient ID: NPC36061

Ingredient ID: NPC34877

Ingredient ID: NPC330144

Ingredient ID: NPC329560

Ingredient ID: NPC329536

Ingredient ID: NPC329085

Ingredient ID: NPC328788

Ingredient ID: NPC328475

Ingredient ID: NPC328447

Ingredient ID: NPC327196

Ingredient ID: NPC326425

Ingredient ID: NPC326257

Ingredient ID: NPC325153

Ingredient ID: NPC324659

Ingredient ID: NPC323434

Ingredient ID: NPC322925

Ingredient ID: NPC322753

Ingredient ID: NPC322385

Ingredient ID: NPC322192

Ingredient ID: NPC322060

Ingredient ID: NPC321917

Ingredient ID: NPC321710

Ingredient ID: NPC321382

Ingredient ID: NPC321136

Ingredient ID: NPC321092

Ingredient ID: NPC320787

Ingredient ID: NPC320362

Ingredient ID: NPC319497

Ingredient ID: NPC318257

Ingredient ID: NPC317787

Ingredient ID: NPC317291

Ingredient ID: NPC317270

Ingredient ID: NPC317120

Ingredient ID: NPC316926

Ingredient ID: NPC316518

Ingredient ID: NPC314184

Ingredient ID: NPC313955

Ingredient ID: NPC313163

Ingredient ID: NPC313082

Ingredient ID: NPC312800

Ingredient ID: NPC309330

Ingredient ID: NPC308265

Ingredient ID: NPC306277

Ingredient ID: NPC305307

Ingredient ID: NPC304748

Ingredient ID: NPC30469

Ingredient ID: NPC302857

Ingredient ID: NPC301585

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC295644

Ingredient ID: NPC295320

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294412

Ingredient ID: NPC294409

Ingredient ID: NPC294037

Ingredient ID: NPC292198

Ingredient ID: NPC290563

Ingredient ID: NPC290319

Ingredient ID: NPC288680

Ingredient ID: NPC285646

Ingredient ID: NPC283557

Ingredient ID: NPC281686

Ingredient ID: NPC28081

Ingredient ID: NPC280749

Ingredient ID: NPC280717

Ingredient ID: NPC279865

Ingredient ID: NPC278068

Ingredient ID: NPC273687

Ingredient ID: NPC273019

Ingredient ID: NPC272614

Ingredient ID: NPC271479

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269648

Ingredient ID: NPC268949

Ingredient ID: NPC266713

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC263727

Ingredient ID: NPC261831

Ingredient ID: NPC259317

Ingredient ID: NPC257711

Ingredient ID: NPC257582

Ingredient ID: NPC257090

Ingredient ID: NPC254482

Ingredient ID: NPC249045

Ingredient ID: NPC247660

Ingredient ID: NPC246558

Ingredient ID: NPC242580

Ingredient ID: NPC241498

Ingredient ID: NPC240084

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC236658

Ingredient ID: NPC234560

Ingredient ID: NPC234133

Ingredient ID: NPC232080

Ingredient ID: NPC231856

Ingredient ID: NPC230301

Ingredient ID: NPC230295

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC226331

Ingredient ID: NPC226027

Ingredient ID: NPC225871

Ingredient ID: NPC225710

Ingredient ID: NPC224368

Ingredient ID: NPC222696

Ingredient ID: NPC222342

Ingredient ID: NPC219143

Ingredient ID: NPC216630

Ingredient ID: NPC216059

Ingredient ID: NPC214770

Ingredient ID: NPC214234

Ingredient ID: NPC21418

Ingredient ID: NPC213876

Ingredient ID: NPC209970

Ingredient ID: NPC209560

Ingredient ID: NPC208793

Ingredient ID: NPC208364

Ingredient ID: NPC20791

Ingredient ID: NPC205478

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC20060

Ingredient ID: NPC199379

Ingredient ID: NPC199072

Ingredient ID: NPC197896

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC196749

Ingredient ID: NPC19660

Ingredient ID: NPC19576

Ingredient ID: NPC193536

Ingredient ID: NPC192402

Ingredient ID: NPC19174

Ingredient ID: NPC190742

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC187738

Ingredient ID: NPC18722

Ingredient ID: NPC186732

Ingredient ID: NPC185755

Ingredient ID: NPC18335

Ingredient ID: NPC180905

Ingredient ID: NPC17810

Ingredient ID: NPC176259

Ingredient ID: NPC174246

Ingredient ID: NPC171736

Ingredient ID: NPC170339

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC167072

Ingredient ID: NPC165967

Ingredient ID: NPC164614

Ingredient ID: NPC164375

Ingredient ID: NPC163652

Ingredient ID: NPC162742

Ingredient ID: NPC161749

Ingredient ID: NPC161700

Ingredient ID: NPC160951

Ingredient ID: NPC158079

Ingredient ID: NPC156865

Ingredient ID: NPC155999

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152489

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149184

Ingredient ID: NPC149155

Ingredient ID: NPC147983

Ingredient ID: NPC14588

Ingredient ID: NPC144877

Ingredient ID: NPC137958

Ingredient ID: NPC137419

Ingredient ID: NPC137167

Ingredient ID: NPC136014

Ingredient ID: NPC133856

Ingredient ID: NPC130683

Ingredient ID: NPC128987

Ingredient ID: NPC128410

Ingredient ID: NPC126681

Ingredient ID: NPC125731

Ingredient ID: NPC123965

Ingredient ID: NPC122212

Ingredient ID: NPC120649

Ingredient ID: NPC120163

Ingredient ID: NPC119952

Ingredient ID: NPC117572

Ingredient ID: NPC117238

Ingredient ID: NPC117096

Ingredient ID: NPC116775

Ingredient ID: NPC116366

Ingredient ID: NPC115723

Ingredient ID: NPC115216

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109699

Ingredient ID: NPC10839

Ingredient ID: NPC107091

Ingredient ID: NPC105511

Ingredient ID: NPC10277

Ingredient ID: NPC102366

Ingredient ID: NPC100971