• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Brassica Oleracea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTAACCTGGAAACAGAACGACCCGGAGAACGTTGAAACATCACTCTCGGTGGGCCGGTTTCTTAGCTGATTTCGTGCCTACAGATTCGGTGGTTATGCGTTGGTCACCGGCCCAGTTTCGGTTGGATCATACGCATAGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATTCAACTAAACGGCCTGCTTTCGCCAACCCGGAGACGGTGTTTGTTCGGAAGCAGTGCTGCAATGTAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATATCGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGATGCCAGGAGGGTCTTGACATGCGGTGGTGAATTCAATTCTCGTCAAAAAAGGGGGCATTCGGTCCGAAAGCTAAGCATGTCCCTCAGTCGCCAACGAATCAGTACAGACATGATGAACTGCAATCC

Click for details-----ITS1

AACACTCTCATATTAGGCACCCAAACCTTACCTTATGCTTCGATCACGGCAGCTGTACGAGCTCGATCACTAGTACCACGCAGTGTGCTGATGCCTGAGTAAAAGTCGTAACAAGTTCCGTAGTGAACTGCGAAGATCATTACCACACCTAAAAACTTTCACGTGAACCGTATAACAATTATAATTGGGGTGATCTTAATGGAGGCTACTAGTCATTTTGGCTGGAGGCTACTATCGAGTGAACCTTATCATGGCGAAAAACTAGACTTTTGTTTGGTGAAGTAGTGAAAATTTTAAACCTTTACTTAAATACTGATTATACTGTGGGGACGAAAGTCTCTACTTTTATTCTAGATAA

Click for details-----ITS2

ATCGTCGTCCCCCCATCCTCTCGAGGATATCGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGATGCCAGGAGGGTCTTGACATGCGGTGGTGAATTCAATTCTCGTCAAAAAAGGGGGCATTCGGTCCGAAAGCTAAGCATGTCCCTCAGTCGCCAACGAATCAGTACAGACATGATGAACTGCAATCC
Taxonomic Information

Plant ID: NPO7576
Plant Latin Name: Brassica Oleracea
Taxonomy Genus: Brassica
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3712
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

205 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


147 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

137 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC99088

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93084

Ingredient ID: NPC91495

Ingredient ID: NPC88603

Ingredient ID: NPC87487

Ingredient ID: NPC86655

Ingredient ID: NPC85813

Ingredient ID: NPC83987

Ingredient ID: NPC82295

Ingredient ID: NPC81989

Ingredient ID: NPC81010

Ingredient ID: NPC78500

Ingredient ID: NPC78312

Ingredient ID: NPC75532

Ingredient ID: NPC65680

Ingredient ID: NPC64866

Ingredient ID: NPC63867

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC60089

Ingredient ID: NPC60088

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC58629

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC52884

Ingredient ID: NPC52752

Ingredient ID: NPC52403

Ingredient ID: NPC50898

Ingredient ID: NPC50266

Ingredient ID: NPC4962

Ingredient ID: NPC490477

Ingredient ID: NPC490470

Ingredient ID: NPC490448

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490375

Ingredient ID: NPC490364

Ingredient ID: NPC490332

Ingredient ID: NPC490327

Ingredient ID: NPC490326

Ingredient ID: NPC490325

Ingredient ID: NPC490273

Ingredient ID: NPC490272

Ingredient ID: NPC490271

Ingredient ID: NPC490270

Ingredient ID: NPC490268

Ingredient ID: NPC490267

Ingredient ID: NPC490266

Ingredient ID: NPC490259

Ingredient ID: NPC490173

Ingredient ID: NPC490110

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC489880

Ingredient ID: NPC48623

Ingredient ID: NPC471895

Ingredient ID: NPC46274

Ingredient ID: NPC45917

Ingredient ID: NPC424

Ingredient ID: NPC41326

Ingredient ID: NPC40330

Ingredient ID: NPC34125

Ingredient ID: NPC331147

Ingredient ID: NPC330253

Ingredient ID: NPC330214

Ingredient ID: NPC328447

Ingredient ID: NPC327330

Ingredient ID: NPC326391

Ingredient ID: NPC326139

Ingredient ID: NPC325065

Ingredient ID: NPC32441

Ingredient ID: NPC322254

Ingredient ID: NPC317120

Ingredient ID: NPC309330

Ingredient ID: NPC307163

Ingredient ID: NPC304927

Ingredient ID: NPC301696

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC291353

Ingredient ID: NPC289974

Ingredient ID: NPC287350

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC279081

Ingredient ID: NPC279026

Ingredient ID: NPC27836

Ingredient ID: NPC278068

Ingredient ID: NPC278010

Ingredient ID: NPC277704

Ingredient ID: NPC272614

Ingredient ID: NPC271732

Ingredient ID: NPC270637

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC2660

Ingredient ID: NPC265607

Ingredient ID: NPC265319

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC261195

Ingredient ID: NPC260837

Ingredient ID: NPC246558

Ingredient ID: NPC246358

Ingredient ID: NPC245346

Ingredient ID: NPC244738

Ingredient ID: NPC242580

Ingredient ID: NPC239032

Ingredient ID: NPC237812

Ingredient ID: NPC23071

Ingredient ID: NPC229235

Ingredient ID: NPC226453

Ingredient ID: NPC226340

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC219246

Ingredient ID: NPC214067

Ingredient ID: NPC2116

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC205917

Ingredient ID: NPC204175

Ingredient ID: NPC204104

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC198596

Ingredient ID: NPC197356

Ingredient ID: NPC197087

Ingredient ID: NPC194944

Ingredient ID: NPC194465

Ingredient ID: NPC193989

Ingredient ID: NPC190454

Ingredient ID: NPC189895

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC187095

Ingredient ID: NPC185755

Ingredient ID: NPC185041

Ingredient ID: NPC181516

Ingredient ID: NPC181300

Ingredient ID: NPC180871

Ingredient ID: NPC180102

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC172064

Ingredient ID: NPC171188

Ingredient ID: NPC170793

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC163556

Ingredient ID: NPC161593

Ingredient ID: NPC159007

Ingredient ID: NPC156768

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC150271

Ingredient ID: NPC149803

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC146342

Ingredient ID: NPC139658

Ingredient ID: NPC137958

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC134825

Ingredient ID: NPC134330

Ingredient ID: NPC133671

Ingredient ID: NPC133588

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC121537

Ingredient ID: NPC119090

Ingredient ID: NPC118429

Ingredient ID: NPC117572

Ingredient ID: NPC116775

Ingredient ID: NPC115469

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC10251

Ingredient ID: NPC100312