• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Raphanus Sativus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGGATCATTGTCGTATCCTGGAAACAGAACGACCCGAGAACGTTGAAACATCACTCTCGGTGGGCTGGGTTCTCTTACCGGAATCCATGCCTTCCGATTCCGTGGTTATGTGTTTCGTCCCCGGTCAAGGCTGGGTCGTGCACATAGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACTAAACAGTATGCTTTCGCCAACCCGGAAACGGTGTTTGTTCGAAAGCAGTTCTGAAATGTAAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATATAGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGATGCCAGGAGCGTCTTGACATGCGGTGGTGAATTCAATCTCCTCGTCATATCGTCGGTCGTTCCGGTCCAAAAGCTCTCGATGACCCAAAGTCCTCAACGCGACCCCAGGTCAGG

Click for details-----ITS1

AGGATCATTGTCGTATCCTGGAAACAGAACGACCCGAGAACGTTGAAACATCACTCTCGGTGGGCTGGGTTCTCTTACCGGAATCCATGCCTTCCGATTCCGTGGTTATGTGTTTCGTCCCCGGTCAAGGCTGGGTCGTGCACATAGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACTAAACAGTATGCTTTCGCCAACCCGGAAACGGTGTTTGTTCGAAAGCAGTTCTGAAATGTAAAGTCTATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7539
Plant Latin Name: Raphanus Sativus
Taxonomy Genus: Raphanus
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3726
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Israel; Italy; India; Philippines; Indonesia; Lebanon; China; Jordan; Thailand; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anthelmintic; Antibacterial; Antifungal; Antiscorbutic; Antispasmodic; Appetizer; Astringent; Cancer; Carminative; Cholagogue; Digestive; Diuretic; Expectorant; Laxative; Poultice; Stomachic

Geographical Distribution

Turkey; Israel; Italy; Lebanon; Philippines; Indonesia; India; China; Thailand; Jordan; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

132 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


65 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

78 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96532

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90896

Ingredient ID: NPC8793

Ingredient ID: NPC85813

Ingredient ID: NPC83743

Ingredient ID: NPC81010

Ingredient ID: NPC77272

Ingredient ID: NPC75717

Ingredient ID: NPC71987

Ingredient ID: NPC70744

Ingredient ID: NPC65680

Ingredient ID: NPC64361

Ingredient ID: NPC63867

Ingredient ID: NPC62045

Ingredient ID: NPC6095

Ingredient ID: NPC59650

Ingredient ID: NPC58279

Ingredient ID: NPC56189

Ingredient ID: NPC55412

Ingredient ID: NPC5413

Ingredient ID: NPC52955

Ingredient ID: NPC52607

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC489907

Ingredient ID: NPC48853

Ingredient ID: NPC48623

Ingredient ID: NPC472612

Ingredient ID: NPC460

Ingredient ID: NPC4506

Ingredient ID: NPC424

Ingredient ID: NPC3780

Ingredient ID: NPC36061

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC3105

Ingredient ID: NPC310075

Ingredient ID: NPC309543

Ingredient ID: NPC307504

Ingredient ID: NPC301585

Ingredient ID: NPC300956

Ingredient ID: NPC297342

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292366

Ingredient ID: NPC290563

Ingredient ID: NPC290460

Ingredient ID: NPC289967

Ingredient ID: NPC289536

Ingredient ID: NPC284285

Ingredient ID: NPC283839

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC272614

Ingredient ID: NPC27226

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269708

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC256073

Ingredient ID: NPC249669

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC231852

Ingredient ID: NPC23131

Ingredient ID: NPC22859

Ingredient ID: NPC226453

Ingredient ID: NPC219138

Ingredient ID: NPC216630

Ingredient ID: NPC211802

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC205586

Ingredient ID: NPC203468

Ingredient ID: NPC202116

Ingredient ID: NPC199379

Ingredient ID: NPC194536

Ingredient ID: NPC19123

Ingredient ID: NPC190454

Ingredient ID: NPC189438

Ingredient ID: NPC189436

Ingredient ID: NPC188167

Ingredient ID: NPC187993

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184078

Ingredient ID: NPC1813

Ingredient ID: NPC17810

Ingredient ID: NPC174647

Ingredient ID: NPC174246

Ingredient ID: NPC171736

Ingredient ID: NPC171713

Ingredient ID: NPC168707

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC165967

Ingredient ID: NPC161135

Ingredient ID: NPC158079

Ingredient ID: NPC157554

Ingredient ID: NPC154932

Ingredient ID: NPC153643

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC145620

Ingredient ID: NPC141765

Ingredient ID: NPC139545

Ingredient ID: NPC139029

Ingredient ID: NPC137958

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC128410

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC125643

Ingredient ID: NPC116775

Ingredient ID: NPC114881

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC109527

Ingredient ID: NPC105023