• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cucumis Sativus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTAAAACATCAAACGACCCGCGAACGCGTTTACAAAACAAACCGACCGCGTCGGGGGCGATGGGGAGGCGAGCACGCTCTTTGCTTGCCTTCCTCCTCCCCCTCCCGGCGCGTCTAAAACAAAACACCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAACTCGCCCGCCCCTCGTACCGGCCTCGGTGGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTTGTCCCCACCCACACAACTCCCCCGCCCACCGTGCGGGCTCGTTGTGCGGGCGAGGGCACACACTGGCCTACCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACGCGTCTCGGCCTCGACGTCGCCTCCACGGACTCCTGCATGACCCTCCGAACGTCGCCCCCGCAAAGGGACGACACTCTCGAC

Click for details-----ITS1

TCGAAGCCTAAAACATCAAACGACCCGCGAACGCGTTTACAAAACAAACCGACCGCGTCGGGGGGCGATGGGGAGGCGAGCACGCTCTTTGCTTGCCTTCCTCCTCCCCCTCCCGGCGCGTCTAAAACAAAACACCGGCGTAGGTCGCGCCAAGGAACTTGAAATGAATTCGCCCGCCCCTCGTACCGGCCTCGGTGGTGCGGGGGGCGGAGCATTCTAGTCGTATTACTAA

Click for details-----ITS2

ATCGTTGTCCCCACCCACACAACTCCCCCGCCCACCGTGCGGGCTCGTTGTGCGGGCGAGGGCACACACTGGCCTACCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGACGCTCGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTGACGCGTCTCGGCCTCGACGTCGCCTCCACGGACTCCTGCATGACCCTCCGAACGTCGCCCCCGCAAAGGGACGACACTCTCGAC
Taxonomic Information

Plant ID: NPO7530
Plant Latin Name: Cucumis Sativus
Taxonomy Genus: Cucumis
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 3659
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

129 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


83 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

79 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96102

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC8747

Ingredient ID: NPC85813

Ingredient ID: NPC81114

Ingredient ID: NPC81015

Ingredient ID: NPC81010

Ingredient ID: NPC78312

Ingredient ID: NPC77192

Ingredient ID: NPC64124

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC61530

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC50898

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490332

Ingredient ID: NPC490288

Ingredient ID: NPC489907

Ingredient ID: NPC489894

Ingredient ID: NPC48623

Ingredient ID: NPC46568

Ingredient ID: NPC424

Ingredient ID: NPC34908

Ingredient ID: NPC328447

Ingredient ID: NPC328286

Ingredient ID: NPC326391

Ingredient ID: NPC322254

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC309330

Ingredient ID: NPC305182

Ingredient ID: NPC304869

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC295644

Ingredient ID: NPC295098

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC291473

Ingredient ID: NPC290319

Ingredient ID: NPC287992

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC278976

Ingredient ID: NPC27836

Ingredient ID: NPC27600

Ingredient ID: NPC272614

Ingredient ID: NPC272343

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC266450

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC260837

Ingredient ID: NPC246749

Ingredient ID: NPC246558

Ingredient ID: NPC246238

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC236357

Ingredient ID: NPC230115

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC217951

Ingredient ID: NPC216077

Ingredient ID: NPC213876

Ingredient ID: NPC209846

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC207554

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC199072

Ingredient ID: NPC197396

Ingredient ID: NPC197087

Ingredient ID: NPC193989

Ingredient ID: NPC191833

Ingredient ID: NPC189436

Ingredient ID: NPC188844

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC180965

Ingredient ID: NPC17810

Ingredient ID: NPC1769

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC161728

Ingredient ID: NPC161593

Ingredient ID: NPC158079

Ingredient ID: NPC15598

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC145703

Ingredient ID: NPC140310

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC128410

Ingredient ID: NPC127254

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC118429

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC10781

Ingredient ID: NPC105501