• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cannabis Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAACAGCAGAACGACCCGTGAACACGTTTTAAACAGCTTGGGCGGGCGAGAGGAGCTTGCTCCTTGGACCCGCCCGCACCTGCTGGGAGAAATCTCGGCGGGCTAACGAACCCCGGCGCAATCTGCGCCAAGGAACAATAAAAGATTATCGCGTGGCTCGTGCGGTGGCCCGGAGACGGTGTCCGCCAATCGAGATGCGTGTTTATCGAAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGCCGTTGCCCCCATGTGCACTGCCAAAAGCGTGTTCAGGAGGGGCGGAGACTGGCTTCCCATGAGCATTGCCTTGTGGTTGGCCTAAATTCGAGTCGTCGGCCGCAATCGCCTCGACATTCGGTGGTTTTCGATTATATCGGTGCCCCGTCGTGCGCGAATCCGTGACCGACTAGACCCGTACGACCCCAATGTGCTGCGAACGCAGTGCCTTCAACGCGACCCCAGGTCAGGCGGGATC

Click for details-----ITS1

GTGACTGCGGAGGCATTGTCGAACCTGCAACAGCAGAACGACCCGTGAACACGTTTTAAACAGCTTGGGCGGGCGAGAGGAGCTTGCTCCTTGGACCCGCCCGCACCTGCTGGGAGAAATCTCGGCGGGCTAACGAACCCCGGCGCAATCTGCGCCAAGGAACAATAAAAGATTATCGCGTGGCTCGTGCGGTGGCCCGGAGACGGTGTCCGCCAATCGAGATGCGTGTTTATCGAAATGTCTAAA

Click for details-----ITS2

GCCGTTGCCCCCATGTGCACTGCCAAAAGCGTGTTCAGGAGGGGCGGAGACTGGCTTCCCATGAGCATTGCCTTGTGGTTGGCCTAAATTCGAGTCGTCGGCCGCAATCGCCTCGACATTCGGTGGTTTTCGATTATATCGGTGCCCCGTCGTGCGCGAATCCGTGACCGACTAGACCCGTACGACCCCAATGTGCTGCGAACGCAGTGCCTTCAACGCGACCCCAGGTCAGGCGGGATC
Taxonomic Information

Plant ID: NPO7513
Plant Latin Name: Cannabis Sativa
Taxonomy Genus: Cannabis
Taxonomy Family: Cannabaceae

Plant External Links:

NCBI TaxonomyDB: 3483
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM; Homeopathy


Medicinal Functions:

Analgesic; Anodyne; Anthelmintic; Antianxiety; Antibacterial; Anticonvulsant; Antiemetic; Antiperiodic; Antirheumatic; Antispasmodic; Cancer; Cholagogue; Demulcent; Diuretic; Emmenagogue; Emollient; Febrifuge; Hypnotic; Laxative; Narcotic; Ophthalmic; Sedative; Tonic

Geographical Distribution

India; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

111 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


62 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

63 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99836

Ingredient ID: NPC97377

Ingredient ID: NPC96940

Ingredient ID: NPC94196

Ingredient ID: NPC92855

Ingredient ID: NPC90566

Ingredient ID: NPC90232

Ingredient ID: NPC8973

Ingredient ID: NPC85813

Ingredient ID: NPC85117

Ingredient ID: NPC77272

Ingredient ID: NPC77249

Ingredient ID: NPC76828

Ingredient ID: NPC66383

Ingredient ID: NPC65839

Ingredient ID: NPC65455

Ingredient ID: NPC62599

Ingredient ID: NPC57279

Ingredient ID: NPC5413

Ingredient ID: NPC48853

Ingredient ID: NPC485093

Ingredient ID: NPC476254

Ingredient ID: NPC476171

Ingredient ID: NPC475831

Ingredient ID: NPC475782

Ingredient ID: NPC474373

Ingredient ID: NPC474372

Ingredient ID: NPC474016

Ingredient ID: NPC472800

Ingredient ID: NPC472799

Ingredient ID: NPC472798

Ingredient ID: NPC472797

Ingredient ID: NPC472796

Ingredient ID: NPC472795

Ingredient ID: NPC46300

Ingredient ID: NPC424

Ingredient ID: NPC4147

Ingredient ID: NPC39362

Ingredient ID: NPC38604

Ingredient ID: NPC37299

Ingredient ID: NPC313673

Ingredient ID: NPC30506

Ingredient ID: NPC300956

Ingredient ID: NPC299568

Ingredient ID: NPC29831

Ingredient ID: NPC294548

Ingredient ID: NPC293551

Ingredient ID: NPC290803

Ingredient ID: NPC287624

Ingredient ID: NPC286111

Ingredient ID: NPC284371

Ingredient ID: NPC278683

Ingredient ID: NPC27534

Ingredient ID: NPC272241

Ingredient ID: NPC270087

Ingredient ID: NPC26974

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC257124

Ingredient ID: NPC252095

Ingredient ID: NPC249669

Ingredient ID: NPC241976

Ingredient ID: NPC241973

Ingredient ID: NPC24101

Ingredient ID: NPC240343

Ingredient ID: NPC239039

Ingredient ID: NPC23694

Ingredient ID: NPC235251

Ingredient ID: NPC234106

Ingredient ID: NPC232223

Ingredient ID: NPC230085

Ingredient ID: NPC223267

Ingredient ID: NPC218753

Ingredient ID: NPC217447

Ingredient ID: NPC217336

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC21157

Ingredient ID: NPC211179

Ingredient ID: NPC209970

Ingredient ID: NPC207420

Ingredient ID: NPC201662

Ingredient ID: NPC195749

Ingredient ID: NPC188844

Ingredient ID: NPC178435

Ingredient ID: NPC176300

Ingredient ID: NPC171736

Ingredient ID: NPC1682

Ingredient ID: NPC16577

Ingredient ID: NPC1656

Ingredient ID: NPC163524

Ingredient ID: NPC160623

Ingredient ID: NPC159754

Ingredient ID: NPC159630

Ingredient ID: NPC154932

Ingredient ID: NPC153958

Ingredient ID: NPC150928

Ingredient ID: NPC14930

Ingredient ID: NPC149184

Ingredient ID: NPC148984

Ingredient ID: NPC146197

Ingredient ID: NPC143326

Ingredient ID: NPC14013

Ingredient ID: NPC136014

Ingredient ID: NPC13451

Ingredient ID: NPC132043

Ingredient ID: NPC130245

Ingredient ID: NPC118885

Ingredient ID: NPC113907

Ingredient ID: NPC10645

Ingredient ID: NPC105493