• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ixora Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAAAGCAAACGACCGCGAACTCGTGTAAATGCCGAGCGTCCGGGAACGGGCGGGGTGACTTAGCCGTCCCTTGCTCCTTCCCTGGCGCTCCCCGTGCGCTCGTCGCACGGACGAACAACTCAACCCCGGCGCGGAATGCGCCAAGGAAAACTTYAAAATGATMGCTCGCTCCCCCTTTGCCCCGTTCGCGGTGCGCAACGGGGGATGCCGTGGCTTCTGTCGTAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCACCCTCCCTCTCCGGGAGGCGGCGGAGATTGGCTTCCCGTGCCCCTAGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAACTCCTCAACTCGAGTCCTTGTTCGTGACGGCAAACCCCGCCGTAAATCGCGCTCCAACGACCCTCAAGCTCGCGTCTCGACTCGAGCCTCGA

Click for details-----ITS1

TCGAATCCTGCAAAGCAAACGACCGCGAACTCGTGTAAATGCCGAGCGTCCGGGAACGGGCGGGGTGACTTAGCCGTCCCTTGCTCCTTCCCTGGCGCTCCCCGTGCGCTCGTCGCACGGACGAACAACTCAACCCCGGCGCGGAATGCGCCAAGGAAAACTTYAAAATGATMGCTCGCTCCCCCTTTGCCCCGTTCGCGGTGCGCAACGGGGGATGCCGTGGCTTCTGTCGTAACCAAAA

Click for details-----ITS2

ATCGCGTCGCCACCCCCCCTCTTCGGGGGGCGGCGGAGATTGGCTTCCCGTGCCCCCTAGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAACTCCTCAACTCGAGTCCTTGTTCGTGACGGCAAACCCCCACCGTAAATCGCGCTCCAACGACCCTCAAGCTCGCGTCTCGACTCGAGCCTCGA
Taxonomic Information

Plant ID: NPO7510
Plant Latin Name: Ixora Chinensis
Taxonomy Genus: Ixora
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 591727
Plant-of-the-World-Online: 753834-1

Used in Medicines

Country/Region:
Malaysia; Philippines; Indonesia; China; Vietnam

Traditional Medicine System:
TCM

Geographical Distribution

Bangladesh; Myanmar; Philippines; Indonesia; Cambodia; Malaysia; Vietnam; China; Colombia; Laos; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

56 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


50 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9794

Ingredient ID: NPC97130

Ingredient ID: NPC94637

Ingredient ID: NPC90232

Ingredient ID: NPC8235

Ingredient ID: NPC68889

Ingredient ID: NPC63697

Ingredient ID: NPC63121

Ingredient ID: NPC51936

Ingredient ID: NPC46151

Ingredient ID: NPC38497

Ingredient ID: NPC37644

Ingredient ID: NPC3649

Ingredient ID: NPC307063

Ingredient ID: NPC290598

Ingredient ID: NPC289480

Ingredient ID: NPC287550

Ingredient ID: NPC27765

Ingredient ID: NPC276262

Ingredient ID: NPC271232

Ingredient ID: NPC264317

Ingredient ID: NPC255042

Ingredient ID: NPC253543

Ingredient ID: NPC25230

Ingredient ID: NPC246358

Ingredient ID: NPC241911

Ingredient ID: NPC236579

Ingredient ID: NPC233533

Ingredient ID: NPC23145

Ingredient ID: NPC230301

Ingredient ID: NPC221825

Ingredient ID: NPC208936

Ingredient ID: NPC208075

Ingredient ID: NPC204498

Ingredient ID: NPC201696

Ingredient ID: NPC197508

Ingredient ID: NPC196434

Ingredient ID: NPC195235

Ingredient ID: NPC193292

Ingredient ID: NPC193258

Ingredient ID: NPC192638

Ingredient ID: NPC190961

Ingredient ID: NPC190810

Ingredient ID: NPC188596

Ingredient ID: NPC182840

Ingredient ID: NPC179694

Ingredient ID: NPC166226

Ingredient ID: NPC163561

Ingredient ID: NPC162186

Ingredient ID: NPC156840

Ingredient ID: NPC141777

Ingredient ID: NPC138113

Ingredient ID: NPC137646

Ingredient ID: NPC119271

Ingredient ID: NPC113733

Ingredient ID: NPC102091