• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aconitum Japonicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAGCGACCCGCGAACAAGTGAAAACAAACCCGGACGTACCGAAGAGGGGCGCATGCCCCCGATCGCTCGCCCGTCGGACCACGACCCCTTCTGCGGCCGCACTGATCTGCGGGCGGAGGGGTGGGTCGTTGTGTCCGCACAAAACCAAAAACCGGCGCGACAGGCGCCAAGGAAATCTTAGCGGAAAAAGAGGGTTGCCCCGTCCGCGGTGGCAGCCTTCAGAATCCGATACTCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACTATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGGACGATACCGATCATGTGCTTGCCCCCCAAGATATGGCCTCTATGACCCACACGTGTCTTTGGACGCTCATGA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGKACCCCGTCAACCAMGTTGTCGGGGAKCGGAGATTGGCCCCCCGGGCCCCTGCGGGCACGGTCGGCACAAATGTTTGTCCCCGGCGGCGAGCGTCGCGGTCAGTGGTGGTTGTATTTCTCATCCTCCAAAGACATCAAGACGCGTCGTCCTCGTTGCACGTTGGGACACATCGACCCCAAGG
Taxonomic Information

Plant ID: NPO7490
Plant Latin Name: Aconitum Japonicum
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 1478108
Plant-of-the-World-Online: 707472-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antirheumatic

Geographical Distribution

Japan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

226 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


78 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

48 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99905

Ingredient ID: NPC99056

Ingredient ID: NPC97209

Ingredient ID: NPC96411

Ingredient ID: NPC96080

Ingredient ID: NPC94687

Ingredient ID: NPC93936

Ingredient ID: NPC90224

Ingredient ID: NPC88470

Ingredient ID: NPC88446

Ingredient ID: NPC87597

Ingredient ID: NPC8733

Ingredient ID: NPC87288

Ingredient ID: NPC86331

Ingredient ID: NPC8504

Ingredient ID: NPC83935

Ingredient ID: NPC83085

Ingredient ID: NPC83047

Ingredient ID: NPC81965

Ingredient ID: NPC81010

Ingredient ID: NPC8009

Ingredient ID: NPC78397

Ingredient ID: NPC72245

Ingredient ID: NPC71930

Ingredient ID: NPC69732

Ingredient ID: NPC69609

Ingredient ID: NPC69318

Ingredient ID: NPC69074

Ingredient ID: NPC66849

Ingredient ID: NPC62742

Ingredient ID: NPC62092

Ingredient ID: NPC61219

Ingredient ID: NPC60721

Ingredient ID: NPC60261

Ingredient ID: NPC60174

Ingredient ID: NPC56549

Ingredient ID: NPC55338

Ingredient ID: NPC54884

Ingredient ID: NPC54230

Ingredient ID: NPC51306

Ingredient ID: NPC49568

Ingredient ID: NPC48127

Ingredient ID: NPC476496

Ingredient ID: NPC476495

Ingredient ID: NPC46391

Ingredient ID: NPC4473

Ingredient ID: NPC43725

Ingredient ID: NPC40851

Ingredient ID: NPC40539

Ingredient ID: NPC40432

Ingredient ID: NPC36730

Ingredient ID: NPC34974

Ingredient ID: NPC34905

Ingredient ID: NPC33836

Ingredient ID: NPC33462

Ingredient ID: NPC33338

Ingredient ID: NPC33276

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC31485

Ingredient ID: NPC312658

Ingredient ID: NPC311889

Ingredient ID: NPC310941

Ingredient ID: NPC306848

Ingredient ID: NPC305305

Ingredient ID: NPC304450

Ingredient ID: NPC302171

Ingredient ID: NPC302021

Ingredient ID: NPC302020

Ingredient ID: NPC300981

Ingredient ID: NPC300020

Ingredient ID: NPC298772

Ingredient ID: NPC297922

Ingredient ID: NPC296120

Ingredient ID: NPC292605

Ingredient ID: NPC290672

Ingredient ID: NPC290668

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289515

Ingredient ID: NPC287976

Ingredient ID: NPC287766

Ingredient ID: NPC287764

Ingredient ID: NPC286569

Ingredient ID: NPC284525

Ingredient ID: NPC283395

Ingredient ID: NPC283202

Ingredient ID: NPC282424

Ingredient ID: NPC281470

Ingredient ID: NPC279928

Ingredient ID: NPC277941

Ingredient ID: NPC277566

Ingredient ID: NPC27699

Ingredient ID: NPC273348

Ingredient ID: NPC272290

Ingredient ID: NPC271472

Ingredient ID: NPC26999

Ingredient ID: NPC267874

Ingredient ID: NPC26777

Ingredient ID: NPC267217

Ingredient ID: NPC265482

Ingredient ID: NPC264317

Ingredient ID: NPC262376

Ingredient ID: NPC260441

Ingredient ID: NPC255962

Ingredient ID: NPC253157

Ingredient ID: NPC252519

Ingredient ID: NPC249360

Ingredient ID: NPC243702

Ingredient ID: NPC239421

Ingredient ID: NPC239345

Ingredient ID: NPC238323

Ingredient ID: NPC23790

Ingredient ID: NPC237384

Ingredient ID: NPC235258

Ingredient ID: NPC234791

Ingredient ID: NPC231164

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC22767

Ingredient ID: NPC226473

Ingredient ID: NPC22573

Ingredient ID: NPC225453

Ingredient ID: NPC225194

Ingredient ID: NPC224601

Ingredient ID: NPC222627

Ingredient ID: NPC219233

Ingredient ID: NPC216737

Ingredient ID: NPC21442

Ingredient ID: NPC212181

Ingredient ID: NPC212106

Ingredient ID: NPC211468

Ingredient ID: NPC210875

Ingredient ID: NPC210262

Ingredient ID: NPC208815

Ingredient ID: NPC208118

Ingredient ID: NPC206632

Ingredient ID: NPC205595

Ingredient ID: NPC205

Ingredient ID: NPC202987

Ingredient ID: NPC20186

Ingredient ID: NPC200099

Ingredient ID: NPC198830

Ingredient ID: NPC19627

Ingredient ID: NPC194963

Ingredient ID: NPC19459

Ingredient ID: NPC194525

Ingredient ID: NPC192390

Ingredient ID: NPC18997

Ingredient ID: NPC187973

Ingredient ID: NPC184195

Ingredient ID: NPC179297

Ingredient ID: NPC178383

Ingredient ID: NPC174515

Ingredient ID: NPC174464

Ingredient ID: NPC173322

Ingredient ID: NPC172769

Ingredient ID: NPC172716

Ingredient ID: NPC172208

Ingredient ID: NPC170442

Ingredient ID: NPC17038

Ingredient ID: NPC170170

Ingredient ID: NPC168829

Ingredient ID: NPC168111

Ingredient ID: NPC16710

Ingredient ID: NPC166985

Ingredient ID: NPC166603

Ingredient ID: NPC166593

Ingredient ID: NPC166521

Ingredient ID: NPC166454

Ingredient ID: NPC165815

Ingredient ID: NPC165189

Ingredient ID: NPC163578

Ingredient ID: NPC163256

Ingredient ID: NPC161848

Ingredient ID: NPC161557

Ingredient ID: NPC160388

Ingredient ID: NPC15981

Ingredient ID: NPC159409

Ingredient ID: NPC15908

Ingredient ID: NPC15812

Ingredient ID: NPC158079

Ingredient ID: NPC155468

Ingredient ID: NPC153674

Ingredient ID: NPC151397

Ingredient ID: NPC149444

Ingredient ID: NPC149309

Ingredient ID: NPC148136

Ingredient ID: NPC145660

Ingredient ID: NPC145291

Ingredient ID: NPC14519

Ingredient ID: NPC145100

Ingredient ID: NPC140311

Ingredient ID: NPC139778

Ingredient ID: NPC138719

Ingredient ID: NPC138015

Ingredient ID: NPC137584

Ingredient ID: NPC1364

Ingredient ID: NPC133807

Ingredient ID: NPC133566

Ingredient ID: NPC128278

Ingredient ID: NPC128262

Ingredient ID: NPC128093

Ingredient ID: NPC12499

Ingredient ID: NPC124690

Ingredient ID: NPC124060

Ingredient ID: NPC12280

Ingredient ID: NPC122094

Ingredient ID: NPC120182

Ingredient ID: NPC119015

Ingredient ID: NPC118333

Ingredient ID: NPC117587

Ingredient ID: NPC117376

Ingredient ID: NPC115207

Ingredient ID: NPC115186

Ingredient ID: NPC112779

Ingredient ID: NPC110027

Ingredient ID: NPC108276

Ingredient ID: NPC108175

Ingredient ID: NPC106840

Ingredient ID: NPC104949

Ingredient ID: NPC104591

Ingredient ID: NPC103598

Ingredient ID: NPC101515

Ingredient ID: NPC100956

Ingredient ID: NPC100551