• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eucalyptus Resinifera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCCCAGCAGAATGACCAGAGAACCGGTAACAAACTCAATGGGGACGGCGGGCTCAGCCCGACGTCCCTCTCGACGTCGAGGATCGGGGCTCGAGCACCTCAGGGCGCTCGGCCTTTGTCCTCGGCGGCGCAACGAACCCCGGCGCGGAATGCGCCAAGGAACTTTAACAAGAGTGCGATGCTCCCGCCGCCCCATACACGGTGCGCGCGCGGGATGCCATGCAATCTCATATTACTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCTTTGGTCGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCAATCCCCCTCGCCCTGGCGAGCGGGGGCTGGGCGCGTACGATGGCCTCCCGCGACGACCACGTCCCGGCTGGCCCAAAATCGAGCGTCGGAGCGATCAGCACCACGGCATTCGGTGGTTGATTAGACCCCAATGATCAATGCCGCGCGTGCCGCTCATGCGCACGCTCTGCGAATCTGCTCCTTACCAACGCGACCCCAG

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7418
Plant Latin Name: Eucalyptus Resinifera
Taxonomy Genus: Eucalyptus
Taxonomy Family: Myrtaceae

Plant External Links:

NCBI TaxonomyDB: 1711506
Plant-of-the-World-Online: 593305-1

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Siddha

Geographical Distribution

Eritrea; Australia; Italy; Portugal; Cuba; Tanzania; India; France; United States; Ethiopia; Trinidad and Tobago; Zimbabwe; Uganda; Kenya; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

80 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98386

Ingredient ID: NPC86371

Ingredient ID: NPC80710

Ingredient ID: NPC78540

Ingredient ID: NPC71726

Ingredient ID: NPC50898

Ingredient ID: NPC46715

Ingredient ID: NPC43143

Ingredient ID: NPC42716

Ingredient ID: NPC41240

Ingredient ID: NPC35544

Ingredient ID: NPC35446

Ingredient ID: NPC34981

Ingredient ID: NPC32641

Ingredient ID: NPC31643

Ingredient ID: NPC308472

Ingredient ID: NPC30720

Ingredient ID: NPC305858

Ingredient ID: NPC297186

Ingredient ID: NPC29391

Ingredient ID: NPC291796

Ingredient ID: NPC284339

Ingredient ID: NPC279668

Ingredient ID: NPC279121

Ingredient ID: NPC277532

Ingredient ID: NPC27225

Ingredient ID: NPC270456

Ingredient ID: NPC263821

Ingredient ID: NPC262435

Ingredient ID: NPC258867

Ingredient ID: NPC258575

Ingredient ID: NPC258035

Ingredient ID: NPC253788

Ingredient ID: NPC253336

Ingredient ID: NPC243083

Ingredient ID: NPC240306

Ingredient ID: NPC234560

Ingredient ID: NPC234051

Ingredient ID: NPC226333

Ingredient ID: NPC222342

Ingredient ID: NPC221466

Ingredient ID: NPC219870

Ingredient ID: NPC213412

Ingredient ID: NPC209560

Ingredient ID: NPC209550

Ingredient ID: NPC20791

Ingredient ID: NPC207744

Ingredient ID: NPC202856

Ingredient ID: NPC196753

Ingredient ID: NPC19174

Ingredient ID: NPC185249

Ingredient ID: NPC181124

Ingredient ID: NPC180279

Ingredient ID: NPC176348

Ingredient ID: NPC175429

Ingredient ID: NPC17542

Ingredient ID: NPC17322

Ingredient ID: NPC17151

Ingredient ID: NPC169749

Ingredient ID: NPC160179

Ingredient ID: NPC156457

Ingredient ID: NPC156139

Ingredient ID: NPC150648

Ingredient ID: NPC147686

Ingredient ID: NPC143427

Ingredient ID: NPC142142

Ingredient ID: NPC139364

Ingredient ID: NPC138994

Ingredient ID: NPC138990

Ingredient ID: NPC130341

Ingredient ID: NPC128678

Ingredient ID: NPC125062

Ingredient ID: NPC121703

Ingredient ID: NPC12013

Ingredient ID: NPC116775

Ingredient ID: NPC107161

Ingredient ID: NPC106439

Ingredient ID: NPC106197

Ingredient ID: NPC102832

Ingredient ID: NPC100284