• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tribulus Terrestris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAACGCACAACGACCCGCGAACATGTTTTTAACACCGGCAGGTCGGGGGTGCGCGAGAGCGCAACTTCTACCTGTCCCCCGGTCCGTTAGCACTCGCGCGATGCGTTCCACGCTCTCCACGGGGACTTGGCCACCGCGCGTTGCTTTATCGGATCATAACAAACCCCGGCGCGGAATGCGTCAAGGAATCTTTAAATGCGTCGGCACGGCCTTGTGACCCTATCGAAGGGCGTCAGTGCCAGTGCACTATTACTACACGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTACCGAATTGCGATACTTATTGTGAATTGCAAAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCACCCCAACCCCCCTCGTGCTTTGGCCGAGGGGCGGGCGGAAATTGGTCTCCCGTTTGCCCAGCCAAGCGGTTGGCCCAAATTCGAGTACTCGGCACCGGCTCTCGCCGACCAACGGTGGTGTAACAACCTCTCGGAGGCAAGTCGCGGGCGCCCTTGCAATCCTGAGGCACTCACGGACCCTGCGCACGGCATTGCTCATG

Click for details-----ITS1

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAACGCACAACGACCCGCGAACATGTTTTTAACACCGGCAGGTCGGGGGTGCGCGAGAGCGCAACTTCTACCTGTCCCCCGGTCCGTTAGCACTCGCGCGATGCGTTCCACGCTCTCCACGGGGACTTGGCCACCGCGCGTTGCTTTATCGGATCATAACAAACCCCGGCGCGGAATGCGTCAAGGAATCTTTAAATGCGTCGGCACGGCCTTGTGACCCTATCGAAGGGCGTCAGTGCCAGTGCACTATTACTACACGAA

Click for details-----ITS2

ATCGTCGCCCCAACCCCCCTCGTGCTTTGGCCGAGGGGCGGGCGGAAATTGGTCTCCCGTTTGCCCAGCCAAGCGGTTGGCCCAAATTCGAGTACTCGGCACCGGCTCTCGCCGACCAACGGTGGTGTAACAACCTCTCGGAGGCAAGTCGCGGGCGCCCTTGCAATCCTGAGGCACTCACGGACCCTGCGCACGGCAGTGCTCATG
Taxonomic Information

Plant ID: NPO7395
Plant Latin Name: Tribulus Terrestris
Taxonomy Genus: Tribulus
Taxonomy Family: Zygophyllaceae

Plant External Links:

NCBI TaxonomyDB: 210369
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India; Algeria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM; Homeopathy


Medicinal Functions:

Abortifacient; Alterative; Anthelmintic; Aphrodisiac; Carminative; Demulcent; Diuretic; Galactogogue; Infertility; Pectoral

Geographical Distribution

India; China; Algeria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

71 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


17 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97700

Ingredient ID: NPC95051

Ingredient ID: NPC90984

Ingredient ID: NPC84059

Ingredient ID: NPC75973

Ingredient ID: NPC7479

Ingredient ID: NPC70744

Ingredient ID: NPC6295

Ingredient ID: NPC58852

Ingredient ID: NPC5723

Ingredient ID: NPC52197

Ingredient ID: NPC4925

Ingredient ID: NPC47517

Ingredient ID: NPC46575

Ingredient ID: NPC39591

Ingredient ID: NPC32932

Ingredient ID: NPC328506

Ingredient ID: NPC326879

Ingredient ID: NPC3254

Ingredient ID: NPC322861

Ingredient ID: NPC320135

Ingredient ID: NPC318995

Ingredient ID: NPC318215

Ingredient ID: NPC316871

Ingredient ID: NPC304971

Ingredient ID: NPC301938

Ingredient ID: NPC300557

Ingredient ID: NPC294830

Ingredient ID: NPC291389

Ingredient ID: NPC282082

Ingredient ID: NPC269056

Ingredient ID: NPC241669

Ingredient ID: NPC24101

Ingredient ID: NPC232727

Ingredient ID: NPC231900

Ingredient ID: NPC230861

Ingredient ID: NPC227702

Ingredient ID: NPC227260

Ingredient ID: NPC223687

Ingredient ID: NPC218109

Ingredient ID: NPC216650

Ingredient ID: NPC216012

Ingredient ID: NPC212278

Ingredient ID: NPC21108

Ingredient ID: NPC207819

Ingredient ID: NPC205003

Ingredient ID: NPC204295

Ingredient ID: NPC204286

Ingredient ID: NPC195749

Ingredient ID: NPC195713

Ingredient ID: NPC18729

Ingredient ID: NPC186898

Ingredient ID: NPC179787

Ingredient ID: NPC178444

Ingredient ID: NPC170438

Ingredient ID: NPC164766

Ingredient ID: NPC163264

Ingredient ID: NPC161035

Ingredient ID: NPC160607

Ingredient ID: NPC160125

Ingredient ID: NPC158823

Ingredient ID: NPC15715

Ingredient ID: NPC153644

Ingredient ID: NPC14963

Ingredient ID: NPC141744

Ingredient ID: NPC137666

Ingredient ID: NPC136730

Ingredient ID: NPC132487

Ingredient ID: NPC116562

Ingredient ID: NPC115165

Ingredient ID: NPC104788