CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Malus Sylvestris

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGAACCTGCAAGGCAGAACGACCCGAGAACCCGTTTCAACGTTTGGGGGGTCGGCGGGCCTCCGGGCCCGGCGTCCCCTTCGTCCCGGGAGCCCGCTCCCGGGCGTACAAACTTACACCGGCGCGTGTTGCGCCAAGGAATATGAACGAAAGAGCGCGCTCCCGTCGCCCCGGAAACGGTGCGCGCGCGGGTGCGTCGTCGTCTTCGATAAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAANAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCCCGCGCATCCCTCGGGAGGGTCGGGAGGGGGCGGACGATGNCCTCCCGTGCGTCACCCCGCGCGGTTGGAATAAATGCCGGGTCCTCGGCGACGAACGCCACGACAATTGGTGGTCGTCGAACCTCGGTTGCCAGTTTGTGTGCTTTCGCCGCGCTCCGAGTGGCCCGAGACGCTTGCTGCTCTTGCTTCGGCGTATTGCTTTCA

Click for details-----ITS1

ATCGGGGGTCGGCGGGCCTCCTGGCCCGGCGTCCCCTTCGTCCCGGGAGCCCGCTCCCGGGCGTACAAACGAACACCGGCGCGTGCTGCGCCAAGGAATCTGAACGAAAGAGCGCGCTCCCGCAGCCCCGGAAACGGTGCGGCCGCGGGTGCGTCGTCGTCTTCGATAAGTCAAAA

Click for details-----ITS2

GCCGTTGCCCCCCCCGCGCATCCCTCGGGAGGGTCGGGAGGGGGCGGACGATGNCCTCCCGTGCGTCACCCCGCGCGGTTGGAATAAATGCCGGGTCCTCGGCGACGAACGCCACGACAATTGGTGGTCGTCGAACCTCGGTTGCCAGTTTGTGTGCTTTCGCCGCGCTCCGAGTGGCCCGAGACGCTTGCTGCTCTTGCTTCGGCGTATTGCTTTCA

Taxonomic Information

Plant ID: NPO7392
Plant Latin Name: Malus Sylvestris
Taxonomy Genus: Malus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 3752
Plant-of-the-World-Online: 726415-1

Used in Medicines

Country/Region:

Turkey; Italy; Indonesia; India; Chile; Argentina; Spain

Traditional Medicine System:

Indian Folk; Unani

Medicinal Functions:

Anthelmintic; Antibacterial; Astringent; Hypnotic; Laxative; Refrigerant

Geographical Distribution

Turkey; Italy; France; Ireland; Argentina; Norway; Australia; Germany; Chile; Belgium; Spain; Ukraine; Netherlands; Denmark; Poland; Indonesia; Sweden; Finland; Switzerland; Russia; Bulgaria; Romania; Albania; Portugal; India; United Kingdom; Austria; Greece; Hungary

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

7 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC85813

Ingredient ID: NPC292419

Ingredient ID: NPC290598

Ingredient ID: NPC264317

Ingredient ID: NPC230301

Ingredient ID: NPC146631

Ingredient ID: NPC113733

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR4	G-protein coupled receptor 120	Q5NUL3	CHEMBL5339
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR1	Free fatty acid receptor 1	O14842	CHEMBL4422
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	11

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00908791	Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue	breast cancer	Linoleic Acid (NPC85813)	NP level
NCT00816504	Effect of Galactose on Permeblity Factor in Patients With FSGS and CKD Stage 5	focal segmental glomerulosclerosis	Galactose (NPC21209)	NP level
NCT00204932	Effects of CLA Supplements on Body Weight and Fat Oxidation	obesity	Linoleic Acid (NPC85813)	NP level
NCT00607945	Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Linoleic Acid (NPC85813)	NP level
NCT00816478	Effect of Oral Galactose on Focal Segmental Glomerulosclerosis (FSGS) Permeability Factor	focal segmental glomerulosclerosis	Galactose (NPC21209)	NP level
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Linoleic Acid (NPC85813)	NP level
NCT00951158	A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors	neoplasm	Linoleic Acid (NPC85813)	NP level
NCT02063802	Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children	obesity	Linoleic Acid (NPC85813)	NP level
NCT00814255	Novel Therapies for Resistant FSGS (FONTII): Phase II Clinical Trial	focal segmental glomerulosclerosis	Galactose (NPC21209)	NP level
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	FABP3,FFAR4,ALOX15,LMNA,AKR1C3,F2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA,ALOX15,FFAR1,FFAR4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	FFAR1,F2 NCT00607945
Focal/segmental autonomic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D8A	NCT00816478,NCT00816504,NCT00814255
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	ALOX15,FFAR1,FFAR4
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALOX15,FABP3,FFAR4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,FABP3,FFAR1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FFAR4,F2,FFAR4
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2 NCT00029679
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT02063802,NCT00204932
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	ALOX15,F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3,F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1C3,F2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FABP3,FFAR1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1C3,AKR1C3
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,FABP3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1C3,F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	ALOX15,F2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,FFAR1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ALOX15,FFAR4
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FABP3,F2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FABP3,FFAR1
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	FFAR1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	AKR1C3
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FFAR1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NCT00908791
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00951158
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NCT00701987
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	FABP3
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ALOX15
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ALOX15
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	FFAR1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	FFAR1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FFAR4
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FFAR1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FFAR4
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Malus Sylvestris

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

7 All known Ingredients in Total

5 Ingredients with Acceptable Bioavailablity

6 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Mesothelioma of pleura

Type 2 diabetes mellitus

Focal/segmental autonomic disorder

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Asthma

Obesity

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Melanoma of skin

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Thrombocytopenia

Ischaemic/haemorrhagic stroke

Myocardial infarction

Coronary thrombosis

Coagulation defect

Angina pectoris

Cerebral ischaemic stroke

Bleeding disorder

Acute diabete complication

Thrombosis

Female pelvic pain

Prostate cancer

Multiple sclerosis

Nutritional deficiency

Cardiovascular disease

Idiopathic interstitial pneumonitis

Breast cancer

Neoplasms

Melanoma

Dysplastic naevus

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Adenocarcinoma of prostate

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Polycystic ovary syndrome

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Glioblastoma of brain

Carpal tunnel syndrome

Gliomas of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities