• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Schisandra Sphenanthera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

TTTGCGTCGCTCCCCTCCCTCCCATTCTCCCTTTTTGGTGTATGGTGTTTGYGAGGAGCGGATATTGGCTGCCCGTGCCAWGTTTGTGCGGTCGGCCGAAAGATGGGCCCCTGGTGTGTTGTGACACGACGAGTGGTGGTCAAATGCCCTTCTCACCGCGTGGGACGTCAAGTCGCATTCCTTGTGGCTCTTGGGACTCTTGGAGCCGCTTCGCGGCAACCAGCA
Taxonomic Information

Plant ID: NPO7385
Plant Latin Name: Schisandra Sphenanthera
Taxonomy Genus: Schisandra
Taxonomy Family: Schisandraceae

Plant External Links:

NCBI TaxonomyDB: 13674
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antirheumatic; Antitussive; Aphrodisiac; Astringent; Cancer; Cardiotonic; Cholagogue; Expectorant; Hepatic; Lenitive; Nervine; Pectoral; Sedative; Stimulant; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


99 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

54 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC96754

Ingredient ID: NPC95675

Ingredient ID: NPC91574

Ingredient ID: NPC87828

Ingredient ID: NPC86939

Ingredient ID: NPC83049

Ingredient ID: NPC79322

Ingredient ID: NPC79273

Ingredient ID: NPC77550

Ingredient ID: NPC77237

Ingredient ID: NPC76451

Ingredient ID: NPC76449

Ingredient ID: NPC74304

Ingredient ID: NPC67986

Ingredient ID: NPC65933

Ingredient ID: NPC63061

Ingredient ID: NPC61828

Ingredient ID: NPC60427

Ingredient ID: NPC57877

Ingredient ID: NPC53722

Ingredient ID: NPC53669

Ingredient ID: NPC470916

Ingredient ID: NPC46277

Ingredient ID: NPC45404

Ingredient ID: NPC42797

Ingredient ID: NPC41474

Ingredient ID: NPC37407

Ingredient ID: NPC36733

Ingredient ID: NPC3621

Ingredient ID: NPC3357

Ingredient ID: NPC33241

Ingredient ID: NPC326223

Ingredient ID: NPC325024

Ingredient ID: NPC323357

Ingredient ID: NPC32189

Ingredient ID: NPC320062

Ingredient ID: NPC319697

Ingredient ID: NPC3155

Ingredient ID: NPC306765

Ingredient ID: NPC305579

Ingredient ID: NPC297271

Ingredient ID: NPC293378

Ingredient ID: NPC292092

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC289258

Ingredient ID: NPC286263

Ingredient ID: NPC285776

Ingredient ID: NPC285734

Ingredient ID: NPC284159

Ingredient ID: NPC283114

Ingredient ID: NPC282665

Ingredient ID: NPC27690

Ingredient ID: NPC276627

Ingredient ID: NPC274356

Ingredient ID: NPC270531

Ingredient ID: NPC269116

Ingredient ID: NPC268130

Ingredient ID: NPC268095

Ingredient ID: NPC267990

Ingredient ID: NPC262345

Ingredient ID: NPC261317

Ingredient ID: NPC256776

Ingredient ID: NPC255133

Ingredient ID: NPC253746

Ingredient ID: NPC244074

Ingredient ID: NPC237312

Ingredient ID: NPC236426

Ingredient ID: NPC235586

Ingredient ID: NPC229218

Ingredient ID: NPC22782

Ingredient ID: NPC227378

Ingredient ID: NPC227211

Ingredient ID: NPC226250

Ingredient ID: NPC22484

Ingredient ID: NPC222986

Ingredient ID: NPC220270

Ingredient ID: NPC217708

Ingredient ID: NPC217706

Ingredient ID: NPC215161

Ingredient ID: NPC211861

Ingredient ID: NPC207702

Ingredient ID: NPC206737

Ingredient ID: NPC202189

Ingredient ID: NPC201404

Ingredient ID: NPC198461

Ingredient ID: NPC195747

Ingredient ID: NPC192402

Ingredient ID: NPC191352

Ingredient ID: NPC19044

Ingredient ID: NPC186975

Ingredient ID: NPC185680

Ingredient ID: NPC18174

Ingredient ID: NPC17941

Ingredient ID: NPC179085

Ingredient ID: NPC176030

Ingredient ID: NPC174999

Ingredient ID: NPC16791

Ingredient ID: NPC165721

Ingredient ID: NPC156860

Ingredient ID: NPC153195

Ingredient ID: NPC152896

Ingredient ID: NPC150329

Ingredient ID: NPC149008

Ingredient ID: NPC148699

Ingredient ID: NPC145722

Ingredient ID: NPC143979

Ingredient ID: NPC131769

Ingredient ID: NPC126405

Ingredient ID: NPC126240

Ingredient ID: NPC118162

Ingredient ID: NPC115784

Ingredient ID: NPC114011

Ingredient ID: NPC103637

Ingredient ID: NPC102256

Ingredient ID: NPC100360