• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rosa Laevigata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGGAGGGTCTTGCGGCTCTGCGCCCCCTTATCCTAGGAGGCGAGTGTCTCGCGTGTTGCATTTCGGTGCTTTCGCTTGATCGACCCTCCTAGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCCCGCCGTCCCGGAGACGGTGCTTGTGCGGGTGGTTTCGTCGTCTTCAATATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGCGTGTTGATCGAGTGCTTTCTTAAATAATGCGTGTCGATCCGTCGATGCTTTCA

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGGAGGGTCTTGCGGCTCTGCGCCCCCTTATCCTAGGAGGCAAGTGTCTTGCGTGTTGCATTTCGGTGCTTTCGCTTGACCGACCCTCCTAGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCCCGCCGTCCCGGAGACGGTGCTTGTGCGGGTGGTTTCGTCGTCTTCAATATGTCTAAA

Click for details-----ITS2

GTCGTTGCCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGCTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGCGTGTTGATCGAGTGCTTTCTTAAATAATGCGTGTCGATCCGTCGATGCTTCA
Taxonomic Information

Plant ID: NPO7372
Plant Latin Name: Rosa Laevigata
Taxonomy Genus: Rosa
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 74652
Plant-of-the-World-Online: 733047-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Anticholesterolemic; Astringent; Cancer; Carminative; Depurative; Diuretic; Emmenagogue; Infertility; Kidney; Stomachic; Vulnerary

Geographical Distribution

Georgia; United States; Trinidad and Tobago; Australia; China; Vietnam; Japan; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

101 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


22 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98508

Ingredient ID: NPC98204

Ingredient ID: NPC9613

Ingredient ID: NPC92120

Ingredient ID: NPC87558

Ingredient ID: NPC84319

Ingredient ID: NPC81463

Ingredient ID: NPC71074

Ingredient ID: NPC71056

Ingredient ID: NPC69361

Ingredient ID: NPC61733

Ingredient ID: NPC61477

Ingredient ID: NPC58190

Ingredient ID: NPC538

Ingredient ID: NPC52256

Ingredient ID: NPC51700

Ingredient ID: NPC50676

Ingredient ID: NPC48040

Ingredient ID: NPC47521

Ingredient ID: NPC45246

Ingredient ID: NPC40078

Ingredient ID: NPC39012

Ingredient ID: NPC329148

Ingredient ID: NPC328825

Ingredient ID: NPC323326

Ingredient ID: NPC320206

Ingredient ID: NPC319760

Ingredient ID: NPC319674

Ingredient ID: NPC318785

Ingredient ID: NPC310014

Ingredient ID: NPC307335

Ingredient ID: NPC30224

Ingredient ID: NPC301989

Ingredient ID: NPC299501

Ingredient ID: NPC298725

Ingredient ID: NPC297205

Ingredient ID: NPC295380

Ingredient ID: NPC290023

Ingredient ID: NPC285576

Ingredient ID: NPC278956

Ingredient ID: NPC278620

Ingredient ID: NPC274392

Ingredient ID: NPC271138

Ingredient ID: NPC270768

Ingredient ID: NPC2701

Ingredient ID: NPC269315

Ingredient ID: NPC266569

Ingredient ID: NPC263935

Ingredient ID: NPC261619

Ingredient ID: NPC259788

Ingredient ID: NPC259733

Ingredient ID: NPC255589

Ingredient ID: NPC25259

Ingredient ID: NPC248331

Ingredient ID: NPC247139

Ingredient ID: NPC243728

Ingredient ID: NPC241838

Ingredient ID: NPC239947

Ingredient ID: NPC234664

Ingredient ID: NPC228236

Ingredient ID: NPC227918

Ingredient ID: NPC227318

Ingredient ID: NPC225710

Ingredient ID: NPC22140

Ingredient ID: NPC220134

Ingredient ID: NPC219876

Ingredient ID: NPC218167

Ingredient ID: NPC216888

Ingredient ID: NPC20791

Ingredient ID: NPC198842

Ingredient ID: NPC193862

Ingredient ID: NPC193505

Ingredient ID: NPC186948

Ingredient ID: NPC179980

Ingredient ID: NPC178134

Ingredient ID: NPC176521

Ingredient ID: NPC174177

Ingredient ID: NPC173134

Ingredient ID: NPC170103

Ingredient ID: NPC167303

Ingredient ID: NPC165179

Ingredient ID: NPC158371

Ingredient ID: NPC15658

Ingredient ID: NPC152743

Ingredient ID: NPC147013

Ingredient ID: NPC146024

Ingredient ID: NPC142415

Ingredient ID: NPC141998

Ingredient ID: NPC141225

Ingredient ID: NPC140186

Ingredient ID: NPC132088

Ingredient ID: NPC126958

Ingredient ID: NPC126029

Ingredient ID: NPC125062

Ingredient ID: NPC122189

Ingredient ID: NPC117118

Ingredient ID: NPC114710

Ingredient ID: NPC113996

Ingredient ID: NPC109878

Ingredient ID: NPC108699

Ingredient ID: NPC100515