CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Crataegus Monogyna

Example Image

PLANiTS DNA barcode

GCCGTTGCCCCCCCTCGCCTCCCTCGGGAGCGTCGGCGGGCGGACGATGGCCTCCCGTGCGCCACCCCGCGCGGTTGGCCCAAATGTCGAGTCCCCGGCGACGAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTGCCTGTTGTGCGCTTTCGCCGCGCTGCGGGCGGCTCGCGACCACCGCGGCTCTGCTTCGGCCGAGCTCTTCA

Taxonomic Information

Plant ID: NPO7339
Plant Latin Name: Crataegus Monogyna
Taxonomy Genus: Crataegus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 140997
Plant-of-the-World-Online: 723820-1

Used in Medicines

Country/Region:

Turkey; Albania; Italy; China; Spain; Bulgaria

Traditional Medicine System:

TCM

Medicinal Functions:

Antispasmodic; Astringent; Cardiotonic; Diuretic; Hypotensive; Sedative; Tonic; Vasodilator

Geographical Distribution

Canada; Turkey; Italy; France; Ireland; Argentina; Norway; Australia; Algeria; China; Belgium; Germany; Iraq; Spain; Ukraine; Netherlands; Libya; Denmark; Finland; United States; Morocco; Sweden; Belarus; Switzerland; New Zealand; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; Tunisia; United Kingdom; Austria; Greece; Hungary; Cyprus

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

0 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)