• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Astragalus Cicer


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GATCATTGTCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATACGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTAGGAGGGGGTGCGTCCCCCCTCTTGCCTGAACACAAACCCCGGCGTTCAATGCGCCAAGGAACTAAAATTCGATCAATGCGCCCCGTCGGCCCGGAGACGGTGCTCTAGCGGTGGTGCCTTGTCACATGATACAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGTACGATACCGATCATGTGCATGCTCTCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGATGCTCATG

Click for details-----ITS1

NA

Click for details-----ITS2

TATCGTTGCCCGATGCCTATTGCAGTGCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAAAATCGAGTCCTTGGTAGGGTGTGCCATGATAGATGGTGGTCGAGTTAGTACGATACCGATCATGTGCATGCTCTCCAAAATATGGCCTCTATGACCCACACGCGTCTTTTGATGCTCATGA
Taxonomic Information

Plant ID: NPO7315
Plant Latin Name: Astragalus Cicer
Taxonomy Genus: Astragalus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 20410
Plant-of-the-World-Online: 476814-1

Used in Medicines

Unknown.

Geographical Distribution

Canada; Turkey; Romania; Belarus; Italy; Poland; France; United States; Switzerland; Austria; Germany; Belgium; Hungary; Ukraine; Russia; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC71874

Ingredient ID: NPC48971

Ingredient ID: NPC302857

Ingredient ID: NPC294902

Ingredient ID: NPC242129

Ingredient ID: NPC225434

Ingredient ID: NPC20791

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC162659

Ingredient ID: NPC133671

Ingredient ID: NPC125244

Ingredient ID: NPC102323