• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pterocarpus Indicus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTAATAAGCTGGCGTCCGGAGAATCATTGTCGATGCCTCACAATCCAGCGCGACCCGCGAACGTGTTTTCCACACGGGCAGGCGATGCTGCTCGGCTGCCCCCGGTGCCGGAACGGGCATCACGCCCCCGAGCGTGCGGGCCTCGTCCCGGCACACAACAACAAAACCCCGGCGCGGAATGCGCCAAGGAAGTCGTAACTGTTTGGCGCTCAGCCCTTTCGGCCCGGAAACGGTGCTCGTACGGGCGGCGCCGCAACACACTCGAGTCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGCCTGCCTGGGTGTCACAAATCGTTGCCCCAATCCCCGCGCCTGTAGGCGCCGGGCGGCGGGACGAATGCTGGCTTCCCGTGAGCGAGCGCCTCGCGGTTGGCCGAAAATCGGGTTCGTGGTGGAGGGCAGCGCCATGACAGACGGTGGTTGAGTGCAATCTCGAGGCCAGTCGTGCGCGGTCCCCTCCGCTAGTCACGGACTCCGTGACCCAACAACGGCATCGATCGCCCATG

Click for details-----ITS1

CCTAATAAGCTGGCGTCCGGAGAATCATTGTCGATGCCTCACAATCCAGCGCGACCCGCGAACGTGTTTTCCACACGGGCAGGCGATGCTGCTCGGCTGCCCCCGGTGCCGGAACGGGCATCACGCCCCCGAGCGTGCGGGCCTCGTCCCGGCACACAACAACAAAACCCCGGCGCGGAATGCGCCAAGGAAGTCGTAACTGTTTGGCGCTCAGCCCTTTCGGCCCGGAAACGGTGCTCGTACGGGCGGCGCCGCAACACACTCGAGTCTAGAA

Click for details-----ITS2

ATCGTTGCCCCAATCCCCGCGCCTGTAGGCGCCGGGCGGCGGGGCGAATGCTGGCTTCCCGCGAGCGAGCGCCTCGCGGTTGGCCGAAAATCGGGCTCGTGGTGGAGGGCAGCGCCATGACAGACGGTGGTTGAGTGCAATCTCGAGGCCAGTCGTGCGCGGTCCCCTCCGCTAGTCATGGACTCCGTGACCCAACAACGGCATCGATCGCCCATGATGCGACCTCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO7255
Plant Latin Name: Pterocarpus Indicus
Taxonomy Genus: Pterocarpus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 100170
Plant-of-the-World-Online: 516487-1

Used in Medicines

Country/Region:
Thailand; Indonesia; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

Bangladesh; Cambodia; Vanuatu; Australia; Papua New Guinea; China; Thailand; Tanzania; Maldives; Philippines; Indonesia; Mauritius; Trinidad and Tobago; Vietnam; Seychelles; Myanmar; India; Sierra Leone; Mozambique; Sri Lanka; Kenya; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

90 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


78 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98850

Ingredient ID: NPC96325

Ingredient ID: NPC91016

Ingredient ID: NPC88135

Ingredient ID: NPC87545

Ingredient ID: NPC83470

Ingredient ID: NPC82460

Ingredient ID: NPC78235

Ingredient ID: NPC74730

Ingredient ID: NPC66343

Ingredient ID: NPC63450

Ingredient ID: NPC62801

Ingredient ID: NPC60288

Ingredient ID: NPC57544

Ingredient ID: NPC52362

Ingredient ID: NPC503

Ingredient ID: NPC50266

Ingredient ID: NPC49151

Ingredient ID: NPC47840

Ingredient ID: NPC46248

Ingredient ID: NPC46170

Ingredient ID: NPC45249

Ingredient ID: NPC40965

Ingredient ID: NPC39426

Ingredient ID: NPC38902

Ingredient ID: NPC3824

Ingredient ID: NPC35472

Ingredient ID: NPC35448

Ingredient ID: NPC32082

Ingredient ID: NPC313163

Ingredient ID: NPC307692

Ingredient ID: NPC304868

Ingredient ID: NPC304836

Ingredient ID: NPC300798

Ingredient ID: NPC295777

Ingredient ID: NPC291428

Ingredient ID: NPC286627

Ingredient ID: NPC284627

Ingredient ID: NPC279000

Ingredient ID: NPC278642

Ingredient ID: NPC275462

Ingredient ID: NPC274986

Ingredient ID: NPC274442

Ingredient ID: NPC272307

Ingredient ID: NPC270334

Ingredient ID: NPC259341

Ingredient ID: NPC257948

Ingredient ID: NPC25590

Ingredient ID: NPC252910

Ingredient ID: NPC250245

Ingredient ID: NPC24971

Ingredient ID: NPC243728

Ingredient ID: NPC238339

Ingredient ID: NPC234333

Ingredient ID: NPC233533

Ingredient ID: NPC231738

Ingredient ID: NPC228287

Ingredient ID: NPC227108

Ingredient ID: NPC226511

Ingredient ID: NPC223455

Ingredient ID: NPC219694

Ingredient ID: NPC213603

Ingredient ID: NPC208075

Ingredient ID: NPC206047

Ingredient ID: NPC199963

Ingredient ID: NPC197356

Ingredient ID: NPC184593

Ingredient ID: NPC184166

Ingredient ID: NPC18367

Ingredient ID: NPC18276

Ingredient ID: NPC173691

Ingredient ID: NPC168422

Ingredient ID: NPC163345

Ingredient ID: NPC161749

Ingredient ID: NPC16050

Ingredient ID: NPC158853

Ingredient ID: NPC156626

Ingredient ID: NPC154429

Ingredient ID: NPC154396

Ingredient ID: NPC153716

Ingredient ID: NPC1517

Ingredient ID: NPC144882

Ingredient ID: NPC144682

Ingredient ID: NPC143211

Ingredient ID: NPC138925

Ingredient ID: NPC137910

Ingredient ID: NPC129341

Ingredient ID: NPC116432

Ingredient ID: NPC108432

Ingredient ID: NPC106992