• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rubus Lambertianus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGAAGGGTCCTACGGCTCCTCGTCCCTTTCCTCGGGAGGCAATCGCCTTGTGTGTTGCATCTCGATGCTCGCACTAGAAAGACCCTCTCGGGCGTACAAACGAACACCGGCGTGTATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCTCGTCGTCCCGGAAACGGTGTGCGTGCGGTTGGTTACGTCATCTTCAATATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCCCCAAACCCCCTCGGGAGTTGGGCGGGACGGATGATGGCCTCCCGTGTGCTCCGTCATGCGGTTGGCATAAAAAACAAGTCCTCGGCGACTAACGCCACGACAATCGGTGGTTGTCAAACCTCTGTTGCCTGTCGTGTGCGCGTGTCGAACGAGGGCTCAAAGAACCATGCTGCATTGATTCGTCGATGCTTTCA

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGAAGGGTCCTACGGCTCCTCGTCCCTTTYCTCGGGAGGCAATCGCCTTGTGYGTTGCATCTCGATGCTCGCACTAGAAAGACCCTCTCGGGCGTACAAACGAACACCGGCGTGTATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCTCGTCGTCCCGGAAACGGTGTGCGTGCGGTTGGTTACGTCATCTTCAATATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO7108
Plant Latin Name: Rubus Lambertianus
Taxonomy Genus: Rubus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 75113
Plant-of-the-World-Online: 737886-1

Used in Medicines

Unknown.

Geographical Distribution

Taiwan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC85276

Ingredient ID: NPC60278

Ingredient ID: NPC46801

Ingredient ID: NPC46159

Ingredient ID: NPC38065

Ingredient ID: NPC302248

Ingredient ID: NPC294185

Ingredient ID: NPC271803

Ingredient ID: NPC254702

Ingredient ID: NPC243635

Ingredient ID: NPC239572

Ingredient ID: NPC194653

Ingredient ID: NPC179950

Ingredient ID: NPC151004

Ingredient ID: NPC139134

Ingredient ID: NPC125732

Ingredient ID: NPC118009