• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Allium Sativum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGGAAGGATCATTGTCGAGTTCCTTTTCGAACAGTTGTGAAATTGTGCTCATACCCGACGAGTACTACGTGTTTGTGCTATTAGTGCATGCGTTGTCTTGGCGGGTTCCCTTTTGCTGCCTTCGTGTTGCTTTATTTGAAGTGAAACGAAGAGCAGAAATAAGACACCGGCACAGTTTGTGCCAAGGACAGTTATTGTTGGAGTGCATTGCCATCGTTTTGATGTGCTTTGTGCTATTCTAGCGAGCATCTGAATGACTCCTGGCAATGGATATCTTGGCTCTCGTGTCGATGAAGAACGTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCACGAGGCCATTAGGTCGAGTGCACGTCTGTTTCGGCGTCATGTATAGCGTCATTCCAATCTCCCACATGCGATGAGTGTGGTTTGGGTKATGATGGGTATGGAGAATGACCTTCCGTGCTTTAATTGTATGGTAGGTTTAAGTGATTGTCGTTGCCAGGTATATGCGAGGCGAATGGTGTATCGAGTTAACACACGATNTCTCTAATCGCGTCCATGAGACCTAGGCATGACTTAGAACTAATCGAAACCGATTTCGACGTTTGCTTCAGTAGCAAGCTCGGACCATGACCTCAGATCAGACGGGGCG

Click for details-----ITS1

TAGAGTTCCTTTTTGAACATTTGTGAAGTTGTACTTATACCCGTCGAGAACTAGGTGTTTGTGCCGYTAGCACTTGCATTGTATAGGCGGGCTCCATTTGCTGCCTTCATCTTATTTCTATTGAAATAAGAAGGAGAGTAGAAATAAGAAACCGGCATGGTTTGTGCCAAGGACAGTTGYTGYTGGAGTGCATTGCCATCATTTTGGTGTGCTTTGTGTTATTCTAGTGAGTGTGTAAA

Click for details-----ITS2

ATAGCGTCATTCCAATCTCCCTCATGCGACGAGTGCATTTTGGGTTATGATGGATATGGAGAATGACCTTCCGTGCTTTAATTGTATGGTAGGTTTAAGTGATTGTCGTTGCCAGTTATATGCGAGGCGAATGGTGTGTCGAGTTAACGCACGATGTCTCTAATCGCGTCCATGAGACCTAGGCATGACTTAGCACTAGCTAAAACCGATTTCGATGTTTGCTTTCGTAGCAGGCTCGGACCATGACCTCAGATCAGCCCAGGTCACCCGCTG
Taxonomic Information

Plant ID: NPO7103
Plant Latin Name: Allium Sativum
Taxonomy Genus: Allium
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: 4682
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Canada; Italy; Turkmenistan; India; Laos; Argentina; Burkina Faso; Israel; Jordan; Kuwait; Thailand; Iraq; Spain; Nigeria; Philippines; Indonesia; Saudi Arabia; United States; Sweden; Vietnam; Russia; Brazil; Pakistan; South Africa; Tunisia; Mexico; Lebanon; Malaysia; China; Greece; South Korea; Guinea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anthelmintic; Antiasthmatic; Anticholesterolemic; Antiseptic; Antispasmodic; Cancer; Cholagogue; Diaphoretic; Diuretic; Expectorant; Febrifuge; Hypoglycaemic; Stimulant; Stings; Stomachic; Tonic; Vasodilator

Geographical Distribution

Brazil; Canada; Italy; Turkmenistan; Guinea; Laos; Argentina; Burkina Faso; Israel; Turkey; China; Kuwait; Jordan; Iraq; Spain; Nigeria; Philippines; Indonesia; Saudi Arabia; United States; Sweden; Vietnam; Thailand; Russia; Pakistan; Mexico; Tunisia; South Africa; India; Malaysia; Greece; Lebanon; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

396 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


316 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

162 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99964

Ingredient ID: NPC99734

Ingredient ID: NPC99006

Ingredient ID: NPC98175

Ingredient ID: NPC96337

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93756

Ingredient ID: NPC93617

Ingredient ID: NPC93194

Ingredient ID: NPC93081

Ingredient ID: NPC93077

Ingredient ID: NPC91972

Ingredient ID: NPC89042

Ingredient ID: NPC88963

Ingredient ID: NPC88603

Ingredient ID: NPC85813

Ingredient ID: NPC85637

Ingredient ID: NPC85488

Ingredient ID: NPC84636

Ingredient ID: NPC8288

Ingredient ID: NPC82287

Ingredient ID: NPC82239

Ingredient ID: NPC81865

Ingredient ID: NPC81669

Ingredient ID: NPC81010

Ingredient ID: NPC80692

Ingredient ID: NPC80017

Ingredient ID: NPC79072

Ingredient ID: NPC78918

Ingredient ID: NPC78312

Ingredient ID: NPC77643

Ingredient ID: NPC77579

Ingredient ID: NPC75247

Ingredient ID: NPC74758

Ingredient ID: NPC74400

Ingredient ID: NPC73767

Ingredient ID: NPC72237

Ingredient ID: NPC7208

Ingredient ID: NPC71119

Ingredient ID: NPC70744

Ingredient ID: NPC68874

Ingredient ID: NPC68873

Ingredient ID: NPC68779

Ingredient ID: NPC68173

Ingredient ID: NPC67532

Ingredient ID: NPC66418

Ingredient ID: NPC66043

Ingredient ID: NPC6516

Ingredient ID: NPC63338

Ingredient ID: NPC62045

Ingredient ID: NPC61305

Ingredient ID: NPC61057

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58959

Ingredient ID: NPC58809

Ingredient ID: NPC58129

Ingredient ID: NPC57020

Ingredient ID: NPC55412

Ingredient ID: NPC55154

Ingredient ID: NPC54199

Ingredient ID: NPC53449

Ingredient ID: NPC52831

Ingredient ID: NPC52620

Ingredient ID: NPC51920

Ingredient ID: NPC51694

Ingredient ID: NPC49871

Ingredient ID: NPC49327

Ingredient ID: NPC491218

Ingredient ID: NPC490483

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490143

Ingredient ID: NPC490128

Ingredient ID: NPC490124

Ingredient ID: NPC490123

Ingredient ID: NPC490102

Ingredient ID: NPC490101

Ingredient ID: NPC490070

Ingredient ID: NPC490068

Ingredient ID: NPC490067

Ingredient ID: NPC489910

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC479875

Ingredient ID: NPC46648

Ingredient ID: NPC45410

Ingredient ID: NPC43577

Ingredient ID: NPC424

Ingredient ID: NPC42150

Ingredient ID: NPC39600

Ingredient ID: NPC39426

Ingredient ID: NPC3857

Ingredient ID: NPC38249

Ingredient ID: NPC36498

Ingredient ID: NPC36287

Ingredient ID: NPC35484

Ingredient ID: NPC34908

Ingredient ID: NPC331064

Ingredient ID: NPC32977

Ingredient ID: NPC328937

Ingredient ID: NPC328447

Ingredient ID: NPC325880

Ingredient ID: NPC325373

Ingredient ID: NPC325274

Ingredient ID: NPC322385

Ingredient ID: NPC322065

Ingredient ID: NPC320611

Ingredient ID: NPC320557

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC311969

Ingredient ID: NPC310385

Ingredient ID: NPC308267

Ingredient ID: NPC307021

Ingredient ID: NPC306551

Ingredient ID: NPC306296

Ingredient ID: NPC306238

Ingredient ID: NPC30612

Ingredient ID: NPC306009

Ingredient ID: NPC305642

Ingredient ID: NPC305134

Ingredient ID: NPC304373

Ingredient ID: NPC3031

Ingredient ID: NPC302632

Ingredient ID: NPC302003

Ingredient ID: NPC301983

Ingredient ID: NPC300326

Ingredient ID: NPC298934

Ingredient ID: NPC29883

Ingredient ID: NPC298509

Ingredient ID: NPC29799

Ingredient ID: NPC297753

Ingredient ID: NPC297084

Ingredient ID: NPC296912

Ingredient ID: NPC295534

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293804

Ingredient ID: NPC293628

Ingredient ID: NPC292869

Ingredient ID: NPC292388

Ingredient ID: NPC292090

Ingredient ID: NPC291473

Ingredient ID: NPC291186

Ingredient ID: NPC291158

Ingredient ID: NPC290319

Ingredient ID: NPC289642

Ingredient ID: NPC288010

Ingredient ID: NPC28779

Ingredient ID: NPC286826

Ingredient ID: NPC286188

Ingredient ID: NPC28583

Ingredient ID: NPC285322

Ingredient ID: NPC282999

Ingredient ID: NPC282595

Ingredient ID: NPC282102

Ingredient ID: NPC281686

Ingredient ID: NPC280619

Ingredient ID: NPC280452

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC27744

Ingredient ID: NPC276424

Ingredient ID: NPC275846

Ingredient ID: NPC275762

Ingredient ID: NPC275716

Ingredient ID: NPC275492

Ingredient ID: NPC275462

Ingredient ID: NPC273757

Ingredient ID: NPC273703

Ingredient ID: NPC273330

Ingredient ID: NPC272830

Ingredient ID: NPC272614

Ingredient ID: NPC2724

Ingredient ID: NPC272256

Ingredient ID: NPC271732

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC267068

Ingredient ID: NPC265305

Ingredient ID: NPC263072

Ingredient ID: NPC262641

Ingredient ID: NPC260837

Ingredient ID: NPC260507

Ingredient ID: NPC258096

Ingredient ID: NPC257582

Ingredient ID: NPC256989

Ingredient ID: NPC256828

Ingredient ID: NPC256788

Ingredient ID: NPC256787

Ingredient ID: NPC255467

Ingredient ID: NPC255076

Ingredient ID: NPC255042

Ingredient ID: NPC255027

Ingredient ID: NPC253679

Ingredient ID: NPC253301

Ingredient ID: NPC25317

Ingredient ID: NPC251860

Ingredient ID: NPC251097

Ingredient ID: NPC251031

Ingredient ID: NPC250563

Ingredient ID: NPC248970

Ingredient ID: NPC248955

Ingredient ID: NPC248367

Ingredient ID: NPC247380

Ingredient ID: NPC246096

Ingredient ID: NPC245419

Ingredient ID: NPC245346

Ingredient ID: NPC245027

Ingredient ID: NPC242580

Ingredient ID: NPC240885

Ingredient ID: NPC240290

Ingredient ID: NPC239277

Ingredient ID: NPC239242

Ingredient ID: NPC237812

Ingredient ID: NPC23697

Ingredient ID: NPC235751

Ingredient ID: NPC234424

Ingredient ID: NPC234356

Ingredient ID: NPC232343

Ingredient ID: NPC231276

Ingredient ID: NPC230960

Ingredient ID: NPC228346

Ingredient ID: NPC228011

Ingredient ID: NPC226453

Ingredient ID: NPC226265

Ingredient ID: NPC226027

Ingredient ID: NPC22594

Ingredient ID: NPC225710

Ingredient ID: NPC225136

Ingredient ID: NPC224223

Ingredient ID: NPC220523

Ingredient ID: NPC220140

Ingredient ID: NPC219978

Ingredient ID: NPC219143

Ingredient ID: NPC218552

Ingredient ID: NPC218298

Ingredient ID: NPC213876

Ingredient ID: NPC21290

Ingredient ID: NPC21078

Ingredient ID: NPC210587

Ingredient ID: NPC209575

Ingredient ID: NPC209277

Ingredient ID: NPC2088

Ingredient ID: NPC208793

Ingredient ID: NPC208485

Ingredient ID: NPC208362

Ingredient ID: NPC20791

Ingredient ID: NPC204364

Ingredient ID: NPC204251

Ingredient ID: NPC203468

Ingredient ID: NPC203440

Ingredient ID: NPC202670

Ingredient ID: NPC202369

Ingredient ID: NPC201284

Ingredient ID: NPC200333

Ingredient ID: NPC199623

Ingredient ID: NPC199072

Ingredient ID: NPC198272

Ingredient ID: NPC197376

Ingredient ID: NPC197087

Ingredient ID: NPC197059

Ingredient ID: NPC196876

Ingredient ID: NPC196733

Ingredient ID: NPC196676

Ingredient ID: NPC196359

Ingredient ID: NPC196333

Ingredient ID: NPC195624

Ingredient ID: NPC195287

Ingredient ID: NPC195000

Ingredient ID: NPC194465

Ingredient ID: NPC194456

Ingredient ID: NPC194207

Ingredient ID: NPC192893

Ingredient ID: NPC191534

Ingredient ID: NPC191136

Ingredient ID: NPC190184

Ingredient ID: NPC189840

Ingredient ID: NPC189436

Ingredient ID: NPC188867

Ingredient ID: NPC187770

Ingredient ID: NPC187217

Ingredient ID: NPC185755

Ingredient ID: NPC184203

Ingredient ID: NPC183815

Ingredient ID: NPC183321

Ingredient ID: NPC183120

Ingredient ID: NPC182840

Ingredient ID: NPC18215

Ingredient ID: NPC18205

Ingredient ID: NPC181987

Ingredient ID: NPC181584

Ingredient ID: NPC179650

Ingredient ID: NPC179576

Ingredient ID: NPC178799

Ingredient ID: NPC178638

Ingredient ID: NPC178152

Ingredient ID: NPC17810

Ingredient ID: NPC177988

Ingredient ID: NPC177281

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC174802

Ingredient ID: NPC174525

Ingredient ID: NPC174406

Ingredient ID: NPC174246

Ingredient ID: NPC173975

Ingredient ID: NPC173721

Ingredient ID: NPC173305

Ingredient ID: NPC172112

Ingredient ID: NPC172093

Ingredient ID: NPC170739

Ingredient ID: NPC169749

Ingredient ID: NPC168614

Ingredient ID: NPC1682

Ingredient ID: NPC167986

Ingredient ID: NPC167400

Ingredient ID: NPC16705

Ingredient ID: NPC164646

Ingredient ID: NPC164498

Ingredient ID: NPC163707

Ingredient ID: NPC162620

Ingredient ID: NPC162547

Ingredient ID: NPC162282

Ingredient ID: NPC160468

Ingredient ID: NPC157538

Ingredient ID: NPC15698

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC156018

Ingredient ID: NPC154064

Ingredient ID: NPC152469

Ingredient ID: NPC152452

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149257

Ingredient ID: NPC149155

Ingredient ID: NPC149081

Ingredient ID: NPC147983

Ingredient ID: NPC146289

Ingredient ID: NPC145373

Ingredient ID: NPC145235

Ingredient ID: NPC145154

Ingredient ID: NPC144916

Ingredient ID: NPC14376

Ingredient ID: NPC142438

Ingredient ID: NPC140872

Ingredient ID: NPC140857

Ingredient ID: NPC139617

Ingredient ID: NPC138603

Ingredient ID: NPC137958

Ingredient ID: NPC137739

Ingredient ID: NPC137136

Ingredient ID: NPC136088

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC134570

Ingredient ID: NPC133836

Ingredient ID: NPC132680

Ingredient ID: NPC132508

Ingredient ID: NPC132307

Ingredient ID: NPC130683

Ingredient ID: NPC126998

Ingredient ID: NPC126925

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC122493

Ingredient ID: NPC121958

Ingredient ID: NPC119554

Ingredient ID: NPC119250

Ingredient ID: NPC119090

Ingredient ID: NPC116775

Ingredient ID: NPC116709

Ingredient ID: NPC116517

Ingredient ID: NPC11609

Ingredient ID: NPC115448

Ingredient ID: NPC115358

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112889

Ingredient ID: NPC111888

Ingredient ID: NPC110511

Ingredient ID: NPC109494

Ingredient ID: NPC108645

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC106551

Ingredient ID: NPC106430

Ingredient ID: NPC103560

Ingredient ID: NPC10151

Ingredient ID: NPC101079

Ingredient ID: NPC100135