• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Zaluzianskya Capensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GGGGGCCTCGGCCCCACTCTTCCCACACGACAAGGGCGATAGCCCGAGTCCTGTGGGCTAACGAACCCCCGGCGCGGAAAGCGCCAAGGAAAACGTAACGAAATGCCACCCTCGTTGATGCCCCGTTCGCGGTGTGCTCGGCGGGAGTGTGCGTCTCTTGAAAGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCCTCCTCCCCCCGGGGAGAGTGGAACGGGGGTGGATATTGGCCTCCCGTGCGCCTCGACGTGCGGCCGGCCCAAATGTGATCCCTGGACGACGCGTGTCGCGATTAGTGGTGGTTGTGAACTCAACTGGTCAGCTGTCGTGCCGTCTCGCGTCGTTCGTCAGGGCATCGTCGCAGACCCAAGCGGAGCTCGTTTTTTCGGGCGCCTTCAAATGCGACCCCAGGTCAGGCGGGATT
Taxonomic Information

Plant ID: NPO7099
Plant Latin Name: Zaluzianskya Capensis
Taxonomy Genus: Zaluzianskya
Taxonomy Family: Scrophulariaceae

Plant External Links:

NCBI TaxonomyDB: 248447
Plant-of-the-World-Online: 812961-1

Used in Medicines

Unknown.

Geographical Distribution

South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC71074

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC311485

Ingredient ID: NPC302241

Ingredient ID: NPC279121

Ingredient ID: NPC253448

Ingredient ID: NPC231018

Ingredient ID: NPC230301

Ingredient ID: NPC206365

Ingredient ID: NPC190771

Ingredient ID: NPC18205

Ingredient ID: NPC142415

Ingredient ID: NPC120163

Ingredient ID: NPC105242

Ingredient ID: NPC103342