• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ammi Majus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AATTGCTCGCCCCCAACCACTCATTCCTTGATGGGATCTGGTATTTGGGCGGAAATTGGCCTCCCGTGCATTGCTGTGCGGCTGGTGCAAAAGTGAGTCTCCGACGACGGACGTCGTGACATCGGTGGTTGTAAAAGACCCTCCTGTCTTGTCGCACGAATCCGCGTCATCTTAGTGAGCTCGAGGACCCTTAGGCGTTACAGACTTTTTCGCCCTAACTGTGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO7090
Plant Latin Name: Ammi Majus
Taxonomy Genus: Ammi
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48026
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Jordan; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; Jordan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

107 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


90 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91858

Ingredient ID: NPC87457

Ingredient ID: NPC86126

Ingredient ID: NPC80230

Ingredient ID: NPC79273

Ingredient ID: NPC74101

Ingredient ID: NPC7302

Ingredient ID: NPC71665

Ingredient ID: NPC68816

Ingredient ID: NPC66501

Ingredient ID: NPC58212

Ingredient ID: NPC56184

Ingredient ID: NPC55138

Ingredient ID: NPC51945

Ingredient ID: NPC50230

Ingredient ID: NPC45956

Ingredient ID: NPC39068

Ingredient ID: NPC3753

Ingredient ID: NPC34497

Ingredient ID: NPC33611

Ingredient ID: NPC33320

Ingredient ID: NPC32938

Ingredient ID: NPC32373

Ingredient ID: NPC32222

Ingredient ID: NPC3182

Ingredient ID: NPC310837

Ingredient ID: NPC310512

Ingredient ID: NPC309399

Ingredient ID: NPC299676

Ingredient ID: NPC297280

Ingredient ID: NPC294575

Ingredient ID: NPC292559

Ingredient ID: NPC285390

Ingredient ID: NPC283039

Ingredient ID: NPC279666

Ingredient ID: NPC277279

Ingredient ID: NPC275856

Ingredient ID: NPC274022

Ingredient ID: NPC269802

Ingredient ID: NPC268466

Ingredient ID: NPC264107

Ingredient ID: NPC263043

Ingredient ID: NPC261652

Ingredient ID: NPC260484

Ingredient ID: NPC260473

Ingredient ID: NPC254808

Ingredient ID: NPC252655

Ingredient ID: NPC247047

Ingredient ID: NPC245948

Ingredient ID: NPC24567

Ingredient ID: NPC241643

Ingredient ID: NPC240308

Ingredient ID: NPC239936

Ingredient ID: NPC237946

Ingredient ID: NPC230968

Ingredient ID: NPC227894

Ingredient ID: NPC227331

Ingredient ID: NPC226008

Ingredient ID: NPC225284

Ingredient ID: NPC224291

Ingredient ID: NPC223064

Ingredient ID: NPC219106

Ingredient ID: NPC218973

Ingredient ID: NPC218525

Ingredient ID: NPC216460

Ingredient ID: NPC215894

Ingredient ID: NPC21430

Ingredient ID: NPC213336

Ingredient ID: NPC210354

Ingredient ID: NPC199786

Ingredient ID: NPC19890

Ingredient ID: NPC197011

Ingredient ID: NPC195777

Ingredient ID: NPC194691

Ingredient ID: NPC193770

Ingredient ID: NPC19202

Ingredient ID: NPC191436

Ingredient ID: NPC188650

Ingredient ID: NPC184639

Ingredient ID: NPC183193

Ingredient ID: NPC181474

Ingredient ID: NPC180903

Ingredient ID: NPC179546

Ingredient ID: NPC172968

Ingredient ID: NPC172298

Ingredient ID: NPC171512

Ingredient ID: NPC169418

Ingredient ID: NPC165780

Ingredient ID: NPC165462

Ingredient ID: NPC165241

Ingredient ID: NPC161923

Ingredient ID: NPC160295

Ingredient ID: NPC156249

Ingredient ID: NPC155922

Ingredient ID: NPC149505

Ingredient ID: NPC146081

Ingredient ID: NPC142545

Ingredient ID: NPC137320

Ingredient ID: NPC133666

Ingredient ID: NPC132263

Ingredient ID: NPC125226

Ingredient ID: NPC119753

Ingredient ID: NPC119277

Ingredient ID: NPC117581

Ingredient ID: NPC115388

Ingredient ID: NPC101755

Ingredient ID: NPC100570