CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Stellera Chamaejasme

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCATAGCAGAACAACTCGTGAACATGTTAGCAAATGTGTTGAGGGGTCATGGTGTCATTGGCTCCATTTCCTCTTAACTGGCCCATGTGGCCAAGATAACCAACCCCGGCGCGGATTGCGCCAAGGAATTGTGATAAGTGAAACGTTTGCCCCATGCCATCACAAGATTGTGTGGGGTCATGCGTGATATGTATATTATAAAGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTAGCCCCTACCACCTATGTTGGTTTGAGGCTGATCATGGCTCTCCCGTCCTCATGGTAGCGCGGTTGGCCTAAATATAGTAACCCTAATGTGGTGTATGCCATGATGAGCGGTGGTTTGTTTAGACTTGCCCTCGTTAAGTCATCGTGTGCAGCATGTCATTAGAGTTGGTTGTCTTTGTACTTTGAATTCCTTCATTCAAAGATAATGCACA

Click for details-----ITS1

TCAAATCCTGCAAAGCAGAACAACCCGTGAACATGTTACCATATGTGTTGAGGGGGCTTGGCGTCATTGGTGCCATTTCCTTTCGACTGGCCCATGTGGCCAAGATAACCAAACCCGGCGCGGATTGCGCCAAGGAATTATGTAACGTTTGCCTCATGCATCTGACACAAGATTGTGTAGGGTCATGCGTGATACGTATTATAAAGAA

Click for details-----ITS2

ATCGTAGCCCTCCCCCAACATTGGTTGGTGCAGGGCTGATAATGGCTCTCCCGTCCTTGTGTAGTGCGGTTGGCCTAAATAGAGTGACCCTAATGTGGTGTATGCCATGATGAGCGGTGGTTTGTCTAGGCTTTCCCTCGTTATGTCATCGTGTGTAGTACATCATTAGAGTTGGTTACCTTTGTATTTTGATCTTTCATACAAAGACAATGCACATT

Taxonomic Information

Plant ID: NPO7067
Plant Latin Name: Stellera Chamaejasme
Taxonomy Genus: Stellera
Taxonomy Family: Thymelaeaceae

Plant External Links:

NCBI TaxonomyDB: 142738
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

India; China

Traditional Medicine System:

Indian Folk; TCM

Medicinal Functions:

Vulnerary

Geographical Distribution

India; China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

54 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC95995

Ingredient ID: NPC81775

Ingredient ID: NPC78612

Ingredient ID: NPC73738

Ingredient ID: NPC69083

Ingredient ID: NPC56840

Ingredient ID: NPC485701

Ingredient ID: NPC485700

Ingredient ID: NPC485699

Ingredient ID: NPC485698

Ingredient ID: NPC485697

Ingredient ID: NPC485696

Ingredient ID: NPC485695

Ingredient ID: NPC485694

Ingredient ID: NPC485693

Ingredient ID: NPC485692

Ingredient ID: NPC485691

Ingredient ID: NPC485690

Ingredient ID: NPC485689

Ingredient ID: NPC485688

Ingredient ID: NPC48151

Ingredient ID: NPC478793

Ingredient ID: NPC474508

Ingredient ID: NPC471942

Ingredient ID: NPC471941

Ingredient ID: NPC471940

Ingredient ID: NPC471939

Ingredient ID: NPC471110

Ingredient ID: NPC469648

Ingredient ID: NPC37745

Ingredient ID: NPC328112

Ingredient ID: NPC309991

Ingredient ID: NPC307178

Ingredient ID: NPC304443

Ingredient ID: NPC302327

Ingredient ID: NPC287789

Ingredient ID: NPC283875

Ingredient ID: NPC276356

Ingredient ID: NPC274282

Ingredient ID: NPC273385

Ingredient ID: NPC271741

Ingredient ID: NPC267801

Ingredient ID: NPC263899

Ingredient ID: NPC26251

Ingredient ID: NPC262265

Ingredient ID: NPC258750

Ingredient ID: NPC258474

Ingredient ID: NPC247553

Ingredient ID: NPC239931

Ingredient ID: NPC239704

Ingredient ID: NPC239568

Ingredient ID: NPC237603

Ingredient ID: NPC234536

Ingredient ID: NPC233581

Ingredient ID: NPC233105

Ingredient ID: NPC22571

Ingredient ID: NPC223464

Ingredient ID: NPC22219

Ingredient ID: NPC221374

Ingredient ID: NPC217901

Ingredient ID: NPC211849

Ingredient ID: NPC20939

Ingredient ID: NPC208543

Ingredient ID: NPC201227

Ingredient ID: NPC193234

Ingredient ID: NPC189226

Ingredient ID: NPC183182

Ingredient ID: NPC182266

Ingredient ID: NPC179464

Ingredient ID: NPC179194

Ingredient ID: NPC171411

Ingredient ID: NPC169222

Ingredient ID: NPC166137

Ingredient ID: NPC161557

Ingredient ID: NPC159226

Ingredient ID: NPC149618

Ingredient ID: NPC145649

Ingredient ID: NPC138641

Ingredient ID: NPC126052

Ingredient ID: NPC114239

Ingredient ID: NPC11410

Ingredient ID: NPC113928

Ingredient ID: NPC102166

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Other cytosolic protein	MAPT	Microtubule-associated protein tau	P10636	CHEMBL1293224

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03059160	Open Label Trial of Triheptanoin (UX007) in Treatment of Rett Syndrome.	Rett syndrome	Tridecanoate (NPC113928)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA9,CA12,MAPT,CA9,CA12,MAPT
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA9,CA12,PRKCQ,CYP1A2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CA9,PRKCQ
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,CA12,CYP1A2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA9,CA12,PRKCQ
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA9,CA12
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA12,CA9
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA9,PRKCQ
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9,MAPT
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,PRKCQ
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA9,CA12
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA9,CA12
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1,CA9
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9,CYP1A2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,PRKCQ
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1,CA9
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA9
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,CA9
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA9,MAPT
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CA9
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	MAPT
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	MAPT
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAPT
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PRKCQ
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	MAPT
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	MAPT
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Rett syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90.4	NCT03059160
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	MAPT
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	PRKCQ
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CA9
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	PRKCQ
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA9
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	PRKCQ
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	PRKCQ

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Stellera Chamaejasme

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

83 All known Ingredients in Total

23 Ingredients with Acceptable Bioavailablity

54 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Hepatocellular carcinoma of liver

Serous cystadenoma,borderline malignancy of ovary

Mesothelioma of pleura

Renal cell carcinoma, chromophobe type

Malignant neoplasms of adrenal gland

Solid tumour/cancer

Breast cancer

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Chronic rhinosinusitis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Invasive carcinoma of breast

Glioblastoma of brain

Acute myeloid leukaemia

Mild neurocognitive disorder

Alzheimer disease

Transplant rejection

Renal cell carcinoma

Choreiform disorder

Mature T-cell lymphoma

Bacterial infection

Parkinsonism

Seborrhoeic dermatitis

Rett syndrome

Coeliac disease

Pheochromocytoma

Osteoarthritis, unspecified

Leishmaniasis

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Myotonic dystrophy

West Nile virus infection

Adenocarcinoma of pancreas

Melanoma of skin

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Germ cell tumour of testis

Carpal tunnel syndrome

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities