• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Astilbe Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACTGCAGAACAACTCGCGAACACGTGGTTAAAAGTATACGCGCGGAGGGGAACGGGCGCCCGCGCGTTCCCCCCGCCGTCGAGCTGCGCCCGGTGACCCGTCGCCCCACAACGCCGGACGTTTGGGGGGGCATTCCCGGGCGCTCCCGGCACAACAACGAACCCCGGCGTGAATTACGCCAAGGAACTTAAAGGAAAGGGCGTTCCTCCGCTGCCGCGCTCGCGCAAGCAACCGGAGGAGGCGCCGTCTTCTTGATGTCTTTAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGTACGCACGTCTCCCGCAAAATCCATCCCCAATTGGGGGGAAAAGGATTTTACGGCGAGCGGAGAATGGCCTCCCGCGCCGAGCGTTCGGCGCGGCTGGCCTAAAAAAGAGTACCGGGCGACGAAACGTCACGACAAGTGGTGGCTTACGAGCCCTCGTGGCCGGCCGGATCTAGTCGTGCGCGCTCGTTGCCCGAGAAACTCTCGATCGAACCCCAACACGTCTGTGACGGACGCTACTGT

Click for details-----ITS1

TCGAAAACTGCATGGCAGAACAACCCGCGAACACGTGGTTAGCCTACACGCGGGGACGGACGGGCGCCCGCTCGTCTTTCCCGCCGTCGGGCTGCGCTCGGCGACCCGTCGCCCCACAACGCCCGGCGTTTGGGGGGGGAGTTCCCGGGCGCTCCCGACCCAACAACGAACCCCGGCGTGAATTGCGCCAAGGATCCTAAAAGAAAGAGCGTTCCCCCGTTGCCGCGTTCGCGCAAAAGCAATCGGAGGAGGSGTCGTCTTCTTGATGTCTTTAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO6947
Plant Latin Name: Astilbe Chinensis
Taxonomy Genus: Astilbe
Taxonomy Family: Saxifragaceae

Plant External Links:

NCBI TaxonomyDB: 268493
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

77 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


45 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98087

Ingredient ID: NPC95657

Ingredient ID: NPC93084

Ingredient ID: NPC87081

Ingredient ID: NPC82648

Ingredient ID: NPC81263

Ingredient ID: NPC77099

Ingredient ID: NPC76744

Ingredient ID: NPC76690

Ingredient ID: NPC71507

Ingredient ID: NPC70783

Ingredient ID: NPC69288

Ingredient ID: NPC60755

Ingredient ID: NPC58942

Ingredient ID: NPC52472

Ingredient ID: NPC50241

Ingredient ID: NPC50100

Ingredient ID: NPC49318

Ingredient ID: NPC476327

Ingredient ID: NPC476318

Ingredient ID: NPC43872

Ingredient ID: NPC32739

Ingredient ID: NPC311873

Ingredient ID: NPC308749

Ingredient ID: NPC301839

Ingredient ID: NPC298128

Ingredient ID: NPC29199

Ingredient ID: NPC291545

Ingredient ID: NPC290690

Ingredient ID: NPC288868

Ingredient ID: NPC287191

Ingredient ID: NPC285184

Ingredient ID: NPC282959

Ingredient ID: NPC260149

Ingredient ID: NPC245838

Ingredient ID: NPC245494

Ingredient ID: NPC244149

Ingredient ID: NPC240575

Ingredient ID: NPC239406

Ingredient ID: NPC237962

Ingredient ID: NPC236579

Ingredient ID: NPC235251

Ingredient ID: NPC229253

Ingredient ID: NPC221706

Ingredient ID: NPC216630

Ingredient ID: NPC214067

Ingredient ID: NPC21180

Ingredient ID: NPC196021

Ingredient ID: NPC195000

Ingredient ID: NPC194458

Ingredient ID: NPC192639

Ingredient ID: NPC189880

Ingredient ID: NPC189226

Ingredient ID: NPC185164

Ingredient ID: NPC18174

Ingredient ID: NPC17733

Ingredient ID: NPC176303

Ingredient ID: NPC167987

Ingredient ID: NPC163076

Ingredient ID: NPC16115

Ingredient ID: NPC161097

Ingredient ID: NPC148236

Ingredient ID: NPC144170

Ingredient ID: NPC142753

Ingredient ID: NPC140316

Ingredient ID: NPC138265

Ingredient ID: NPC136996

Ingredient ID: NPC133593

Ingredient ID: NPC130871

Ingredient ID: NPC128061

Ingredient ID: NPC127122

Ingredient ID: NPC115884

Ingredient ID: NPC111689

Ingredient ID: NPC111110

Ingredient ID: NPC106729

Ingredient ID: NPC10642

Ingredient ID: NPC104316