• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ixora Coccinea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAAAGCAGACGACCGCGAACTTGTGTAACTGCCGGGCGTCTGGGAAACGAGCGGGGTGACTTCACCGTCCCTTGCTCCTTTTTCCTGGCGCTCCCCGTGCGCTCGTCGCACGGACCAACAACTCAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTGAAAATGATCGCTCGCTCCCCCTTTGCCCCGTTCGCGGTGCGCAACGGGGGATGTCGCAGCGTCTGTCGTAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCACCCCCCATCTCCGGGGGGCGGCGGAGATTGGCTTCCCGTGCTCCTAGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAACTCCTCAACTCGAGTCCTTGTTCGTGACGGCAGACCCCCACCGTAAATCGCGCTCCAACGACCCTCAAGCTCGCGTCTCGACTCGAGCCTCGACC

Click for details-----ITS1

TCGAATCCTGCAAAGCAGACGACCGCGAACTTGTGTAACTGCCGGGCGTCTGGGAAACGAGCGGGGTGACTTCACCGTCCCTTGCTCCTTTTTCCTGGCGCTCCCCGTGCGCTCGTCGCACGGACCAACAACTCAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTGAAAATGATCGCTCGCTCCCCCTTTGCCCCGTTCGCGGTGCGCAACGGGGGATGTCGCAGCGTCTGTCGTAACCAAAA

Click for details-----ITS2

ATCGCGTCGCCACCCCCCATCTCCGGGGGGCGGCGGAGATTGGCTTCCCGTGCTCCTAGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAACTCCTCAACTCGAGTCCTTGTTCGTGACGGCAGACCCCCACCGTAAATCGCGCTCCAACGACCCTCAAGCTCGCGTCTCGACTCGAGCCTCGACC
Taxonomic Information

Plant ID: NPO6876
Plant Latin Name: Ixora Coccinea
Taxonomy Genus: Ixora
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 43503
Plant-of-the-World-Online: 753844-1

Used in Medicines

Country/Region:
Philippines; Indonesia; India; Vietnam; Thailand; Nigeria

Traditional Medicine System:
Indian Folk; Ayurveda; Siddha

Geographical Distribution

Australia; Honduras; Bangladesh; Mexico; El Salvador; Gambia; Philippines; Indonesia; India; Costa Rica; Cambodia; Nicaragua; Senegal; Vietnam; Colombia; Sri Lanka; Thailand; Nigeria; Belize; Fiji

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

28 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

23 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC79190

Ingredient ID: NPC76336

Ingredient ID: NPC51700

Ingredient ID: NPC473206

Ingredient ID: NPC469944

Ingredient ID: NPC469941

Ingredient ID: NPC469940

Ingredient ID: NPC469938

Ingredient ID: NPC469937

Ingredient ID: NPC44720

Ingredient ID: NPC36201

Ingredient ID: NPC279121

Ingredient ID: NPC278427

Ingredient ID: NPC267691

Ingredient ID: NPC261012

Ingredient ID: NPC249570

Ingredient ID: NPC249281

Ingredient ID: NPC246913

Ingredient ID: NPC219876

Ingredient ID: NPC218871

Ingredient ID: NPC192744

Ingredient ID: NPC192638

Ingredient ID: NPC182634

Ingredient ID: NPC181786

Ingredient ID: NPC170174

Ingredient ID: NPC148915

Ingredient ID: NPC126029

Ingredient ID: NPC116775