CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Rosa Canina

Example Image

PLANiTS DNA barcode

GTCGTTGCCCCCCCCCAACCCCCTCGGGAGTTGGATGGGACGGATGATGGCCTCCCGTGTGCTCAGTCACGCGGTTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTCAAACCTCGGTTTCCTGTCGTGCGCGCGTGTTGATCGAGTGCTTTCTTAAACAATGCGTGTCAATCCGTCGATGCTGACA

Taxonomic Information

Plant ID: NPO683
Plant Latin Name: Rosa Canina
Taxonomy Genus: Rosa
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 74635
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)