CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Camchaya Loloana

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AGGGACATTGTCAATGTCAGTTTAGAATGATTTGTGAACAAGTAAAGACATGGTTGGATGTTTGGGTGATGAGCGTTGCTTATGTACTCCTTCATCTTTGCTGATGGACATTTATAATGCTTTTGATGGGCATTGTACTTGTCTTGATGGCATCAAAACAATCCCCAGCACGGAATGTGCCAAGGAAATGAAAAATCAAAAGAAAGATGTGGCTTGTGATGCTTTGTTTATGATGTGTCATTAGCCCTTTCACTTTTGAAATCAAAAATGACTCTTGACAACGGATATCTTGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAATCATTTGGTTGAGGGCACGTCTGCCTGGGCATCACACATTGTGTCACCCTTTAAAACATTTGTCTAATGGTAAATGCTTAGTCAAGGGTGGAGATTGGTCTCCTGTGCCTATGGTATGGTTGGCCTAAATGGAAGTCCTTTAAGATTGATGCATGACTGTTGGTGGTTGAAAACACTTGTGTTTAGAGTTGTGGATCATATGTTGCAAGGAAAAAACTTTATGAAAGACCCTTACATGATGTTGTGTTGATGTTCAAATGCGATCCCAGTCA

Click for details-----ITS1

Click for details-----ITS2

ATTGTGTCACCCTTTAAAACATTTGTCTAATGGTAAATGCTTAGTTAAGGGTGGAGATTGGTCTCCTGTGCCTATGGTATGGTTGGCCTAAATGGAAGTCCTTTAAGATTGATGCATGACTGTTGGTGGTTGAAAACACTTGTGTTTAGAGTTGTGGATCATATGTTGCAAGGAAAAAACTTTATGAAAGACCCTTACATGATGTTGCGTTGATGTTTCAA

Taxonomic Information

Plant ID: NPO6790
Plant Latin Name: Camchaya Loloana
Taxonomy Genus: Camchaya
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1075355
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC79056

Ingredient ID: NPC78540

Ingredient ID: NPC50898

Ingredient ID: NPC43763

Ingredient ID: NPC39426

Ingredient ID: NPC313163

Ingredient ID: NPC294852

Ingredient ID: NPC284556

Ingredient ID: NPC279121

Ingredient ID: NPC257756

Ingredient ID: NPC233824

Ingredient ID: NPC192638

Ingredient ID: NPC117418

Ingredient ID: NPC116775

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Cytochrome P450	Cytochrome P450 family 2	CYP2C19	Cytochrome P450 2C19	P33261	CHEMBL3622
Therapeutic Target	Enzyme	BLM	Bloom syndrome protein	P54132	CHEMBL1293237
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESRRB	Estrogen-related receptor beta	O95718	CHEMBL3751
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESRRA	Estrogen-related receptor alpha	P11474	CHEMBL3429
Therapeutic Target	Oxidoreductase	CBR1	Carbonyl reductase [NADPH] 1	P16152	CHEMBL5586
Therapeutic Target	Oxidoreductase	XDH	Xanthine dehydrogenase	P47989	CHEMBL1929
Therapeutic Target	Oxidoreductase	HSD17B1	Estradiol 17-beta-dehydrogenase 1	P14061	CHEMBL3181
Therapeutic Target	Oxidoreductase	AOX1	Aldehyde oxidase	Q06278	CHEMBL3257
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	MKNK1	MAP kinase-interacting serine/threonine-protein kinase MNK1	Q9BUB5	CHEMBL4718
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Kinase	MAP2K4	Dual specificity mitogen-activated protein kinase kinase 4	P45985	CHEMBL2897
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Secreted protein	TTR	Transthyretin	P02766	CHEMBL3194
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	25

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00590538	Phenylbutyrate/Genistein Duotherapy in Delta F508-Heterozygotes (for Cystic Fibrosis)	cystic fibrosis	Genistein (NPC39426)	NP level
NCT01489813	Study of Genistein in Reducing Side Effects of Superficial Bladder Cancer Treatment	urinary bladder cancer	Genistein (NPC39426)	NP level
NCT04482595	BIO 300 Oral Suspension in Previously Hospitalized Long COVID Patients	pulmonary fibrosis;severe acute respiratory syndrome	Genistein (NPC39426)	NP level
NCT00005827	Genistein in Treating Patients With Stage II, Stage III, or Stage IV Prostate Cancer	prostate cancer	Genistein (NPC39426)	NP level
NCT01985763	Genistein in Treatment of Metastatic Colorectal Cancer	colorectal carcinoma;malignant colon neoplasm;rectum cancer	Genistein (NPC39426)	NP level
NCT02766478	Genistein Supplementation to Mitigate Cardiometabolic Dysfunction in Patients Undergoing Androgen Deprivation Therapy for Prostate Cancer	prostate cancer	Genistein (NPC39426)	NP level
NCT00118040	Phase II Study of Isoflavone G-2535 (Genistein) in Patients With Bladder Cancer	urinary bladder carcinoma	Genistein (NPC39426)	NP level
NCT00546039	Synthetic Genistein (BONISTEIN™) in Patients Who Are Undergoing Surgery for Prostate Cancer	prostate adenocarcinoma	Genistein (NPC39426)	NP level
NCT00001696	A Pharmacokinetic Study of Genistein, a Tyrosine Kinase Inhibitor	cancer	Genistein (NPC39426)	NP level
NCT00287690	Isoflavones and the Coronary Circulation in Men and Women With Coronary Artery Disease	coronary artery disease	Genistein (NPC39426)	NP level
NCT00882765	Genistein in Treating Patients With Pancreatic Cancer That Can Be Removed by Surgery	pancreatic carcinoma	Genistein (NPC39426)	NP level
NCT01664650	Effects of Genistein in Postmenopausal Women With Metabolic Syndrome	metabolic syndrome	Genistein (NPC39426)	NP level
NCT01628471	MTD Determination, Safety and Efficacy of the Decitabine-Genistein Drug Combination in Advanced Solid Tumors and Non-Small Cell Lung Cancer	non-small cell lung carcinoma	Genistein (NPC39426)	NP level
NCT00244933	Gemcitabine Hydrochloride and Genistein in Treating Women With Stage IV Breast Cancer	breast cancer	Genistein (NPC39426)	NP level
NCT00376948	Genistein, Gemcitabine, and Erlotinib in Treating Patients With Locally Advanced or Metastatic Pancreatic Cancer	pancreatic carcinoma	Genistein (NPC39426)	NP level
NCT00290758	Genistein in Preventing Breast Cancer in Women at High Risk for Breast Cancer	breast cancer	Genistein (NPC39426)	NP level
NCT01126879	Genistein in Treating Patients With Prostate Cancer	prostate adenocarcinoma	Genistein (NPC39426)	NP level
NCT02567799	BIO 300 Non-Small Cell Lung Cancer Study	non-small cell lung carcinoma	Genistein (NPC39426)	NP level
NCT00541710	Effect of Genistein in Women With Metabolic Syndrome	metabolic syndrome	Genistein (NPC39426)	NP level
NCT00010686	Dietary Phytoestrogens and Bone Metabolism	osteoporosis	Genistein (NPC39426)	NP level
NCT00016744	Phenylbutyrate/Genistein Duotherapy in Delta F508-Homozygous(for Cystic Fibrosis)	cystic fibrosis	Genistein (NPC39426)	NP level
NCT00584532	Effects of a Genistein Concentrated Polysaccharide (GCP) for Prostate Cancer on Active Surveillance.	prostate cancer	Genistein (NPC39426)	NP level
NCT00058266	Genistein in Treating Patients With Localized Prostate Cancer Who Are Planning to Undergo Radical Prostatectomy	prostate cancer	Genistein (NPC39426)	NP level
NCT00330096	Effects of Hesperidin on Bone Mineral Density and Bone Metabolism of Postmenopausal Women	osteoporosis	Hesperidin (NPC79056)	NP level
NCT01325311	Cholecalciferol and Genistein Before Surgery in Treating Patients With Early Stage Prostate Cancer	prostate adenocarcinoma	Genistein (NPC39426)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	BLM,CA7,HSD17B1,CA12,MMP12,CYP2C9,XDH,TSHR,CBR1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AOX1,MAOB,ESR2,ESR1 NCT02766478,NCT00584532,NCT00005827,NCT00058266
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	BLM,ACHE,CA4,NOX4,TTR,MMP12,XDH,MAPT
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	BLM,CSNK2A3,CYP1B1,CA12,DPP4,AOX1,CYP19A1,TSHR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	BLM,CA4,CA12,NOX4,MMP12,CYP19A1,AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	BLM,TSHR,NOX4,MMP12,FLT3,DPP4,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	TYR,ACHE,CYP2C9,CYP19A1,XDH,MMP12,TSHR
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,ESRRB,ESR2,THPO,CYP1A1,CYP2C9,CYP2C19
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA7,CYP1B1,NOX4,CA12,MMP12,DPP4,XDH
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	BLM,ESRRB,MMP12,CYP1A1,CYP2C9,XDH,HSD17B2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	ESRRB,CYP1B1,NOX4,THPO,ESR1,DPP4,AOX1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ESRRA,AHR,ESRRB,DPP4,FLT3 MMP12
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	BLM,HSD17B1,TTR,CYP1A2,CYP2C9,AKR1B1
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	FLT3,MKNK2,MKNK1,EGFR NCT01985763
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,MAPT,MAOB,FLT3,ESR2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4,CBR1,MMP12,ESRRB,ESRRA
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR NCT01325311,NCT01126879,NCT00546039
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA4,ESRRB,ACHE,HSD17B1,DPP4
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	EGFR,ESRRB,HIF1A,CYP19A1,XDH
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	BLM,CA12,MMP12,THPO,ESR1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,ESRRA,TTR,CA12,CYP1A2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE,GSK3B,MAOB,MAPT
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR,MKNK2,MKNK1,HIF1A
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MKNK2,CSNK2A1,MKNK1,EGFR
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	BLM,NOX4,MMP12,CYP19A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE,DPP4,CYP19A1,CBR1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	TYR,NOX4,MMP12,CYP1A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,HSD17B1,MMP12,XDH
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	BLM,ACHE,NOX4,MMP12
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	BLM,NOX4,MMP12,AHR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	FLT3,GSK3B,MAPT
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3,ESRRA,ESRRB
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE,AKR1B1,CA4
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MMP12,FLT3,EGFR
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1,ESR1,ESR2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA4,CYP2C9,CA12
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ESRRB,ESRRA,AHR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A,ESR1,EGFR
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESRRA,ESRRB,ESR2
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4 NCT01664650,NCT00541710
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	EGFR NCT01628471,NCT02567799
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,ESRRB,CYP1A1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ESRRA,AKR1B1
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR,MAOB
Contact dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK00-EK0Z	ESRRB,ESRRA
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	FLT3,EGFR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,DPP4
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR,ESR2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1,ESRRA
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1,ESR1
Skin disease Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA00-EM0Z	ESRRA,ESRRB
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	FLT3,DPP4
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	MAOB,ACHE
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4,ESR1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,AHR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP12,EGFR
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO,DPP4
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,GSK3B
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	ESRRA,ESRRB
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,CES1
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TYR,EGFR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1,ACHE
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12,CA4
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1,AKR1B1
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR2,ESR1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	FLT3,AHR
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	ESR1,FLT3
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MAOB,HIF1A
Eyelid inflammatory disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A02	ESRRB,ESRRA
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE,MAPT
Osteoporosis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83.1	NCT00010686,NCT00330096
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT00590538,NCT00016744
Malignant neoplasm of pancreas, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.Z	NCT00882765,NCT00376948
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	MMP12 NCT04482595
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,TSHR
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR,CYP2C9
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4,MMP12
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,HSD17B2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	NOX4,MMP12
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4,ESRRB
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NOX4,TTR
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4,MMP12
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1,MMP12
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	HSD17B2,ACHE
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CSNK2A1,ACHE,CISD1,AHR,EGFR,PSMB5,CSNK2A2,AOX1,CBR1,BLM,NOX4,MAOB,CA12,ESR2,THPO,TSHR,AKR1B1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	ESRRB,CA4,HIF1A,CSNK2A1,ESRRA,ESR1,AOX1,XDH,MKNK2,GSK3B,FLT3,AHR,CA12,MKNK1,EGFR
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A1,CISD1,MMP12,XDH,HSD17B2,AHR,PSMB5,ESRRA,ESRRB,NOX4,CSNK2A3,CA12,CYP1A2,ESR1,TSHR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	BLM,ACHE,CA7,CISD1,CYP1B1,TTR,CES1,DPP4,HIF1A,CYP2C9,MAOB,XDH,HSD17B2,CBR1,CYP2C19
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	BLM,ACHE,CA4,CA12,NOX4,TTR,DPP4,HIF1A,CYP2C9,ESRRA,AKR1B1,XDH,HSD17B2,AHR
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA7,MMP12,DPP4,XDH,HSD17B2,AHR,EGFR,CSNK2A2,AOX1,CBR1,FLT3,TYR,CA12
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	ESRRB,CA7,CISD1,TSHR,MMP12,PSMB5,DPP4,ESRRA,CYP19A1,XDH,HSD17B2,AKR1B1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,CISD1,MMP12,DPP4,MAPT,HSD17B2,CYP1B1,PSMB5,CYP2C9,ESRRB,FLT3,AKR1B1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	BLM,CA4,CA12,NOX4,MMP12,CYP19A1,MAPT,CA12,MMP12,CYP19A1,MAPT
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	BLM,ACHE,CA7,CA12,TTR,MMP12,THPO,CYP2C9,XDH,TSHR,CBR1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR1,CYP19A1,EGFR,CA4,CA12,ESR2,MKNK2,MKNK1 NCT00290758,NCT00244933
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A1,MMP12,MAPT,CA4,HIF1A,BLM,NOX4,CSNK2A3,ESR2,AKR1B1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	BLM,CA4,CA7,NOX4,CA12,MMP12,DPP4,CYP19A1,HSD17B2,CBR1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	MAOB
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	MAPT
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	FLT3
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	EGFR
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	EGFR
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOB
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	FLT3
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	TTR
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOB
Skin cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30-2C37	MAOB
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	EGFR
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	TSHR
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	FLT3
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	AHR
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	ESR1
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FLT3
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	XDH
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Degenerative high myopia Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B76	ESRRA
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	MAOB
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ESR1
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	ESR1
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOB
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	MAOB
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	MAOB
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Primary psychotic disorder manifestation Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A25	MAOB
Vitamin deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B55-5B5F	AOX1
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	EGFR
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	ESR1
Severe acute respiratory syndrome Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D65	NCT04482595
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT00287690
Neoplasms of unknown behaviour of urinary organs Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F98	NCT00118040
Malignant neoplasms of bladder, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.Z	NCT01489813
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT00001696
Malignant neoplasms of colon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	NCT01985763
Rectum cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B92	NCT01985763
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP12
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	MMP12
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FLT3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Camchaya Loloana

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

14 All known Ingredients in Total

9 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Squamous cell carcinoma of bronchus or lung

Prostate cancer

Pheochromocytoma

Glioblastoma of brain

Hepatoblastoma

Leishmaniasis

Other specified malignant neoplasms of kidney, except renal pelvis

Cytomegaloviral disease

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Carpal tunnel syndrome

Psoriasis

Urothelial carcinoma of bladder

Colorectal cancer

Alzheimer disease

Asthma

Adenocarcinoma of prostate

Superficial ovarian endometriosis

Chikungunya virus disease

Invasive carcinoma of breast

Renal cell carcinoma, chromophobe type

Parkinsonism

Mature T-cell lymphoma

Liver cancer

Adenocarcinoma of stomach

West Nile virus infection

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of oesophagus

Gliomas of brain

Acute myeloid leukaemia

Inflammatory arthropathy

Glaucoma

Lung cancer

Hyper-lipoproteinaemia

Bacterial infection

Atopic eczema

Brain cancer

Vasomotor/allergic rhinitis

Metabolic disorder

Non-small cell lung cancer

Systemic lupus erythematosus

Cushing syndrome

Rheumatoid arthritis

Acquired hypomelanotic disorder

Contact dermatitis

Chronic pain

Acute diabete complication

Hepatitis virus infection

Schizophrenia

Endometriosis

Skin disease

Malignant haematopoietic neoplasm

Dementia

Diabetes mellitus, type unspecified

Myelodysplastic syndrome

Renal cell carcinoma

Myocardial infarction

Myeloproliferative neoplasm

Postoperative inflammation

Chronic arterial occlusive disease

Melanoma

Pain, unspecified

Seborrhoeic dermatitis