• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ononis Spinosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTTATATCAAATCCAACACGCGAATCTGTTTCAACATTTTAGGTTCGAAGGCAGACGACACARTGCGTCCTCCTTTCTACCAAACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATCTTGATCTTAGCACGCCTGCACGGMKTCGGAGACGACAATYGTGTTGCGTGTGCTTTGACACCTTATATTATAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTCCTGCCAACATCCTGTTCACAGGGYGTTGTGCACGGCAAATGTTGGCCTCCCGTAGCTCTTCCGGCTCACGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATTGATGGTGGTTGTGTGCCTCACGAGAACTTGAAAATCATACACTACTCTGCCAAAAGCGGCCTCCGTTACCCATTTTGCGTTTGCGAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTA

Click for details-----ITS1

TCGATACCTTATATCAAATCCAACACGCGAATCTGTTTCAACATTTTAGGTTCGAAGGCAGACGACACARTGCGTCCTCCTTTCTACCAAACTCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATCTTGATCTTAGCACGCCTGCACGGMKTCGGAGACGACAATYGTGTTGCGTGTGCTTTGACACCTTATATTATAA

Click for details-----ITS2

ATCGAAGCCTCCTGCCAACATCTTGTTCACAGGGCGTTGTGCACGGCAAATGTTGGCCTCCCGTAGCTCTTCCGGTTCACGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATTGATGGTGGTTGTGTGCCTCACGAGAACTTGAAAATCATACACTACTCTGCCAAAACGTGGCCTCCGTTACCCATTTTGCGTTTGCGAACGCTAGTGATGA
Taxonomic Information

Plant ID: NPO6731
Plant Latin Name: Ononis Spinosa
Taxonomy Genus: Ononis
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 58890
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Albania; Jordan; Bulgaria

Traditional Medicine System:


Medicinal Functions:

Antirheumatic; Antitussive; Aperient; Diuretic; Lithontripic

Geographical Distribution

Turkey; Albania; Jordan; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

245 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


165 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

76 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99588

Ingredient ID: NPC98304

Ingredient ID: NPC96768

Ingredient ID: NPC95603

Ingredient ID: NPC9494

Ingredient ID: NPC93071

Ingredient ID: NPC92681

Ingredient ID: NPC91369

Ingredient ID: NPC90670

Ingredient ID: NPC854

Ingredient ID: NPC83126

Ingredient ID: NPC81500

Ingredient ID: NPC81010

Ingredient ID: NPC80443

Ingredient ID: NPC79576

Ingredient ID: NPC78949

Ingredient ID: NPC78364

Ingredient ID: NPC78307

Ingredient ID: NPC76390

Ingredient ID: NPC76083

Ingredient ID: NPC75660

Ingredient ID: NPC74304

Ingredient ID: NPC72300

Ingredient ID: NPC70744

Ingredient ID: NPC69282

Ingredient ID: NPC69173

Ingredient ID: NPC68779

Ingredient ID: NPC68620

Ingredient ID: NPC68014

Ingredient ID: NPC67905

Ingredient ID: NPC67704

Ingredient ID: NPC66441

Ingredient ID: NPC62874

Ingredient ID: NPC61998

Ingredient ID: NPC597

Ingredient ID: NPC59547

Ingredient ID: NPC58019

Ingredient ID: NPC57887

Ingredient ID: NPC56261

Ingredient ID: NPC56042

Ingredient ID: NPC53269

Ingredient ID: NPC5219

Ingredient ID: NPC50898

Ingredient ID: NPC48898

Ingredient ID: NPC47844

Ingredient ID: NPC46964

Ingredient ID: NPC46674

Ingredient ID: NPC46610

Ingredient ID: NPC4659

Ingredient ID: NPC46356

Ingredient ID: NPC45712

Ingredient ID: NPC45429

Ingredient ID: NPC44846

Ingredient ID: NPC44804

Ingredient ID: NPC44715

Ingredient ID: NPC44696

Ingredient ID: NPC41964

Ingredient ID: NPC41160

Ingredient ID: NPC39883

Ingredient ID: NPC39162

Ingredient ID: NPC39068

Ingredient ID: NPC38893

Ingredient ID: NPC37468

Ingredient ID: NPC36238

Ingredient ID: NPC35797

Ingredient ID: NPC34156

Ingredient ID: NPC34089

Ingredient ID: NPC33090

Ingredient ID: NPC31960

Ingredient ID: NPC313009

Ingredient ID: NPC312105

Ingredient ID: NPC311430

Ingredient ID: NPC311195

Ingredient ID: NPC309981

Ingredient ID: NPC309169

Ingredient ID: NPC308311

Ingredient ID: NPC307323

Ingredient ID: NPC30472

Ingredient ID: NPC304667

Ingredient ID: NPC304555

Ingredient ID: NPC30430

Ingredient ID: NPC30250

Ingredient ID: NPC302

Ingredient ID: NPC3009

Ingredient ID: NPC300689

Ingredient ID: NPC299552

Ingredient ID: NPC298897

Ingredient ID: NPC295471

Ingredient ID: NPC295207

Ingredient ID: NPC29353

Ingredient ID: NPC292276

Ingredient ID: NPC292203

Ingredient ID: NPC292092

Ingredient ID: NPC291428

Ingredient ID: NPC290830

Ingredient ID: NPC290445

Ingredient ID: NPC289186

Ingredient ID: NPC287658

Ingredient ID: NPC286088

Ingredient ID: NPC285315

Ingredient ID: NPC284512

Ingredient ID: NPC283637

Ingredient ID: NPC279969

Ingredient ID: NPC279666

Ingredient ID: NPC279013

Ingredient ID: NPC277205

Ingredient ID: NPC276154

Ingredient ID: NPC275493

Ingredient ID: NPC275471

Ingredient ID: NPC271584

Ingredient ID: NPC26960

Ingredient ID: NPC269451

Ingredient ID: NPC268466

Ingredient ID: NPC266337

Ingredient ID: NPC26540

Ingredient ID: NPC265125

Ingredient ID: NPC264797

Ingredient ID: NPC264779

Ingredient ID: NPC262817

Ingredient ID: NPC262094

Ingredient ID: NPC260783

Ingredient ID: NPC260473

Ingredient ID: NPC260323

Ingredient ID: NPC259491

Ingredient ID: NPC258386

Ingredient ID: NPC258047

Ingredient ID: NPC25769

Ingredient ID: NPC256006

Ingredient ID: NPC254533

Ingredient ID: NPC254478

Ingredient ID: NPC25290

Ingredient ID: NPC252096

Ingredient ID: NPC250975

Ingredient ID: NPC250323

Ingredient ID: NPC249018

Ingredient ID: NPC248807

Ingredient ID: NPC248739

Ingredient ID: NPC248068

Ingredient ID: NPC246162

Ingredient ID: NPC244617

Ingredient ID: NPC244281

Ingredient ID: NPC243086

Ingredient ID: NPC242964

Ingredient ID: NPC242006

Ingredient ID: NPC239584

Ingredient ID: NPC239134

Ingredient ID: NPC239098

Ingredient ID: NPC238823

Ingredient ID: NPC237591

Ingredient ID: NPC236785

Ingredient ID: NPC236769

Ingredient ID: NPC23581

Ingredient ID: NPC23486

Ingredient ID: NPC233357

Ingredient ID: NPC228354

Ingredient ID: NPC226997

Ingredient ID: NPC225888

Ingredient ID: NPC225284

Ingredient ID: NPC225107

Ingredient ID: NPC224941

Ingredient ID: NPC222471

Ingredient ID: NPC221896

Ingredient ID: NPC221371

Ingredient ID: NPC219913

Ingredient ID: NPC219789

Ingredient ID: NPC219573

Ingredient ID: NPC2194

Ingredient ID: NPC218359

Ingredient ID: NPC218258

Ingredient ID: NPC217898

Ingredient ID: NPC216520

Ingredient ID: NPC215118

Ingredient ID: NPC212960

Ingredient ID: NPC210433

Ingredient ID: NPC209930

Ingredient ID: NPC209560

Ingredient ID: NPC208198

Ingredient ID: NPC208077

Ingredient ID: NPC20791

Ingredient ID: NPC202189

Ingredient ID: NPC196941

Ingredient ID: NPC195855

Ingredient ID: NPC194208

Ingredient ID: NPC190907

Ingredient ID: NPC190453

Ingredient ID: NPC190036

Ingredient ID: NPC186227

Ingredient ID: NPC185578

Ingredient ID: NPC180675

Ingredient ID: NPC179467

Ingredient ID: NPC179024

Ingredient ID: NPC176740

Ingredient ID: NPC176130

Ingredient ID: NPC175914

Ingredient ID: NPC173105

Ingredient ID: NPC171796

Ingredient ID: NPC171460

Ingredient ID: NPC170394

Ingredient ID: NPC169949

Ingredient ID: NPC169707

Ingredient ID: NPC169649

Ingredient ID: NPC169336

Ingredient ID: NPC164295

Ingredient ID: NPC164022

Ingredient ID: NPC163567

Ingredient ID: NPC162496

Ingredient ID: NPC161923

Ingredient ID: NPC160308

Ingredient ID: NPC159191

Ingredient ID: NPC15654

Ingredient ID: NPC152069

Ingredient ID: NPC146657

Ingredient ID: NPC14606

Ingredient ID: NPC145952

Ingredient ID: NPC1455

Ingredient ID: NPC144961

Ingredient ID: NPC143765

Ingredient ID: NPC143455

Ingredient ID: NPC14203

Ingredient ID: NPC141782

Ingredient ID: NPC141002

Ingredient ID: NPC138870

Ingredient ID: NPC138299

Ingredient ID: NPC138189

Ingredient ID: NPC1362

Ingredient ID: NPC134064

Ingredient ID: NPC12962

Ingredient ID: NPC127907

Ingredient ID: NPC127467

Ingredient ID: NPC121277

Ingredient ID: NPC118177

Ingredient ID: NPC116112

Ingredient ID: NPC114239

Ingredient ID: NPC113776

Ingredient ID: NPC112785

Ingredient ID: NPC112650

Ingredient ID: NPC11212

Ingredient ID: NPC111845

Ingredient ID: NPC111332

Ingredient ID: NPC110291

Ingredient ID: NPC10646

Ingredient ID: NPC103189

Ingredient ID: NPC102748

Ingredient ID: NPC101864

Ingredient ID: NPC100082