• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Juniperus Brevifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGGTTCGAGACCCTGAATCGTGTAGGGGAAGGAGCTCGCCTCCCCTCCCCGCCCCCAAAATCTCGGCGACGTGCGGACACTTGGCCTTGCAGCGATGTGCTGGACGGCCAAGCTAAAGGGTCCCGCGCCGTCGCGGTCGAGGGTCATCGAATGCCGCGATCGAAAGCGTGGATTCCCTGCGGTGCGAAGAGACTCGGACGCAAAATCTGGATCGCAACTGGTGCCTTCGAACGACGTCTACGTCGGAGCGAGAGGTCCCTGCTCGGTTGTATAGGTTCAGAGGACGTCCGGGCCTCGTCCCCCGTTGAGATTTCATGGCTCGGTCGTGTGCGCGGCGCTGTGCCAGGGATCCGTCGATTCGTCGGCGGCAAGTCGGGACTGCCGCAACCCCCCGTTGCGTTTGCTCAGGTGTTAAGTGGCCGCTGGGAGCGTTCTGTGTTCAGGATGGGTGCACTCGCATGATCTGCGTGGCAGGGGCCCCCGTCCGACGGCACGACTCTCCCTTGCGGCGACTCCCACCTTTGCGAGGTGATGGGGCGGGGACACACCACAGCGTTCTTCGTCGCCCCCCTCGGGCGCTCGGAGGGCGGGATGTGTCAACACCCAACACACGGGTGCGCATCGCGCACCTTAGAAATCCAAAAGAAATGAAGTGCGATCCAGCGCCTTGTGCGCTTGGGTCGGACGAAAGAGGAAAAAACATAACAAAATCA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO6729
Plant Latin Name: Juniperus Brevifolia
Taxonomy Genus: Juniperus
Taxonomy Family: Cupressaceae

Plant External Links:

NCBI TaxonomyDB: 746017
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

186 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

71 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99971

Ingredient ID: NPC95347

Ingredient ID: NPC88278

Ingredient ID: NPC88126

Ingredient ID: NPC87172

Ingredient ID: NPC869

Ingredient ID: NPC83975

Ingredient ID: NPC79482

Ingredient ID: NPC79223

Ingredient ID: NPC78540

Ingredient ID: NPC7777

Ingredient ID: NPC75355

Ingredient ID: NPC71852

Ingredient ID: NPC68889

Ingredient ID: NPC66655

Ingredient ID: NPC66356

Ingredient ID: NPC66001

Ingredient ID: NPC65003

Ingredient ID: NPC64548

Ingredient ID: NPC63159

Ingredient ID: NPC61201

Ingredient ID: NPC59804

Ingredient ID: NPC59033

Ingredient ID: NPC58068

Ingredient ID: NPC57853

Ingredient ID: NPC5685

Ingredient ID: NPC54045

Ingredient ID: NPC52908

Ingredient ID: NPC5208

Ingredient ID: NPC50997

Ingredient ID: NPC49074

Ingredient ID: NPC4856

Ingredient ID: NPC45338

Ingredient ID: NPC44840

Ingredient ID: NPC43462

Ingredient ID: NPC41681

Ingredient ID: NPC37250

Ingredient ID: NPC37111

Ingredient ID: NPC36130

Ingredient ID: NPC35185

Ingredient ID: NPC34355

Ingredient ID: NPC32451

Ingredient ID: NPC312137

Ingredient ID: NPC312132

Ingredient ID: NPC311423

Ingredient ID: NPC311082

Ingredient ID: NPC31027

Ingredient ID: NPC30973

Ingredient ID: NPC308002

Ingredient ID: NPC307699

Ingredient ID: NPC306443

Ingredient ID: NPC305162

Ingredient ID: NPC303044

Ingredient ID: NPC302989

Ingredient ID: NPC302857

Ingredient ID: NPC300498

Ingredient ID: NPC300412

Ingredient ID: NPC295371

Ingredient ID: NPC294902

Ingredient ID: NPC294185

Ingredient ID: NPC29314

Ingredient ID: NPC289415

Ingredient ID: NPC287539

Ingredient ID: NPC287144

Ingredient ID: NPC285620

Ingredient ID: NPC283178

Ingredient ID: NPC282243

Ingredient ID: NPC28198

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC276121

Ingredient ID: NPC274885

Ingredient ID: NPC27184

Ingredient ID: NPC271218

Ingredient ID: NPC270768

Ingredient ID: NPC267296

Ingredient ID: NPC26474

Ingredient ID: NPC261022

Ingredient ID: NPC259147

Ingredient ID: NPC258978

Ingredient ID: NPC255042

Ingredient ID: NPC254861

Ingredient ID: NPC25442

Ingredient ID: NPC243728

Ingredient ID: NPC243299

Ingredient ID: NPC241784

Ingredient ID: NPC240971

Ingredient ID: NPC236579

Ingredient ID: NPC236219

Ingredient ID: NPC234030

Ingredient ID: NPC233646

Ingredient ID: NPC232954

Ingredient ID: NPC232574

Ingredient ID: NPC231710

Ingredient ID: NPC230035

Ingredient ID: NPC228329

Ingredient ID: NPC225879

Ingredient ID: NPC224389

Ingredient ID: NPC222959

Ingredient ID: NPC220011

Ingredient ID: NPC21932

Ingredient ID: NPC219313

Ingredient ID: NPC21855

Ingredient ID: NPC218445

Ingredient ID: NPC218426

Ingredient ID: NPC218284

Ingredient ID: NPC217465

Ingredient ID: NPC213908

Ingredient ID: NPC211669

Ingredient ID: NPC210685

Ingredient ID: NPC208470

Ingredient ID: NPC206095

Ingredient ID: NPC20593

Ingredient ID: NPC199819

Ingredient ID: NPC199

Ingredient ID: NPC198827

Ingredient ID: NPC197633

Ingredient ID: NPC197259

Ingredient ID: NPC195863

Ingredient ID: NPC195368

Ingredient ID: NPC193734

Ingredient ID: NPC189142

Ingredient ID: NPC187805

Ingredient ID: NPC185290

Ingredient ID: NPC183950

Ingredient ID: NPC183491

Ingredient ID: NPC183

Ingredient ID: NPC182814

Ingredient ID: NPC179950

Ingredient ID: NPC179695

Ingredient ID: NPC1786

Ingredient ID: NPC178306

Ingredient ID: NPC17810

Ingredient ID: NPC177013

Ingredient ID: NPC176740

Ingredient ID: NPC17567

Ingredient ID: NPC17514

Ingredient ID: NPC174679

Ingredient ID: NPC1713

Ingredient ID: NPC170035

Ingredient ID: NPC169906

Ingredient ID: NPC169038

Ingredient ID: NPC16797

Ingredient ID: NPC165

Ingredient ID: NPC162840

Ingredient ID: NPC160127

Ingredient ID: NPC15942

Ingredient ID: NPC157378

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC156044

Ingredient ID: NPC145693

Ingredient ID: NPC145356

Ingredient ID: NPC145252

Ingredient ID: NPC143394

Ingredient ID: NPC138453

Ingredient ID: NPC137987

Ingredient ID: NPC137894

Ingredient ID: NPC130593

Ingredient ID: NPC130308

Ingredient ID: NPC12944

Ingredient ID: NPC129088

Ingredient ID: NPC127647

Ingredient ID: NPC127056

Ingredient ID: NPC125036

Ingredient ID: NPC123754

Ingredient ID: NPC121151

Ingredient ID: NPC11978

Ingredient ID: NPC118343

Ingredient ID: NPC117725

Ingredient ID: NPC115802

Ingredient ID: NPC115674

Ingredient ID: NPC114361

Ingredient ID: NPC112954

Ingredient ID: NPC111732

Ingredient ID: NPC111032

Ingredient ID: NPC108526

Ingredient ID: NPC108218

Ingredient ID: NPC107702

Ingredient ID: NPC107149

Ingredient ID: NPC106477

Ingredient ID: NPC103225

Ingredient ID: NPC103213

Ingredient ID: NPC102981

Ingredient ID: NPC10147

Ingredient ID: NPC100521